1302 lines
733 KiB
HTML
1302 lines
733 KiB
HTML
|
<!DOCTYPE html>
|
|||
|
|
<html lang="en" class="light TridactylThemeDefault" style="scroll-behavior: unset;"><head style="scroll-behavior: unset;">
|
|||
|
|
<meta http-equiv="content-type" content="text/html; charset=UTF-8">
|
|||
|
|
<meta charset="utf-8" style="scroll-behavior: unset;">
|
|||
|
|
<link rel="icon" href="https://chat.depeuter.dev/favicon.png" style="scroll-behavior: unset;">
|
|||
|
|
<link rel="manifest" href="https://chat.depeuter.dev/manifest.json" style="scroll-behavior: unset;">
|
|||
|
|
<meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1" style="scroll-behavior: unset;">
|
|||
|
|
<meta name="robots" content="noindex,nofollow" style="scroll-behavior: unset;">
|
|||
|
|
<script style="scroll-behavior: unset;">
|
|||
|
|
// On page load or when changing themes, best to add inline in `head` to avoid FOUC
|
|||
|
|
(() => {
|
|||
|
|
if (
|
|||
|
|
localStorage.theme === 'light' ||
|
|||
|
|
(!('theme' in localStorage) && window.matchMedia('(prefers-color-scheme: light)').matches)
|
|||
|
|
) {
|
|||
|
|
document.documentElement.classList.add('light');
|
|||
|
|
} else if (localStorage.theme && localStorage.theme !== 'system') {
|
|||
|
|
localStorage.theme.split(' ').forEach((e) => {
|
|||
|
|
document.documentElement.classList.add(e);
|
|||
|
|
});
|
|||
|
|
} else if (localStorage.theme && localStorage.theme === 'system') {
|
|||
|
|
systemTheme = window.matchMedia('(prefers-color-scheme: dark)').matches;
|
|||
|
|
document.documentElement.classList.add(systemTheme ? 'dark' : 'light');
|
|||
|
|
} else {
|
|||
|
|
document.documentElement.classList.add('dark');
|
|||
|
|
}
|
|||
|
|
|
|||
|
|
window.matchMedia('(prefers-color-scheme: dark)').addListener((e) => {
|
|||
|
|
if (localStorage.theme === 'system') {
|
|||
|
|
if (e.matches) {
|
|||
|
|
document.documentElement.classList.add('dark');
|
|||
|
|
document.documentElement.classList.remove('light');
|
|||
|
|
} else {
|
|||
|
|
document.documentElement.classList.add('light');
|
|||
|
|
document.documentElement.classList.remove('dark');
|
|||
|
|
}
|
|||
|
|
}
|
|||
|
|
});
|
|||
|
|
})();
|
|||
|
|
</script>
|
|||
|
|
|
|||
|
|
|
|||
|
|
<link rel="modulepreload" href="https://chat.depeuter.dev/_app/immutable/entry/start.5d6541b9.js" style="scroll-behavior: unset;">
|
|||
|
|
<link rel="modulepreload" href="https://chat.depeuter.dev/_app/immutable/chunks/scheduler.358ed94d.js" style="scroll-behavior: unset;">
|
|||
|
|
<link rel="modulepreload" href="https://chat.depeuter.dev/_app/immutable/chunks/singletons.ad06f104.js" style="scroll-behavior: unset;">
|
|||
|
|
<link rel="modulepreload" href="https://chat.depeuter.dev/_app/immutable/chunks/index.e26c72ae.js" style="scroll-behavior: unset;">
|
|||
|
|
<link rel="modulepreload" href="https://chat.depeuter.dev/_app/immutable/entry/app.fd2ba386.js" style="scroll-behavior: unset;">
|
|||
|
|
<link rel="modulepreload" href="https://chat.depeuter.dev/_app/immutable/chunks/preload-helper.a4192956.js" style="scroll-behavior: unset;">
|
|||
|
|
<link rel="modulepreload" href="https://chat.depeuter.dev/_app/immutable/chunks/index.12a3562a.js" style="scroll-behavior: unset;">
|
|||
|
|
<script src="3defcfa5-d9a8-4558-8248-c137bd79a095_files/page-script.js" id="bw-fido2-page-script" style="scroll-behavior: unset;"></script><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/nodes/0.9aef2f82.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/index.a7c302c4.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/navigation.9ff04ca6.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/globals.7f7f1b26.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/each.9f7b73db.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/index.7f13f86a.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/Toaster.svelte_svelte_type_style_lang.8459d519.js" style="scroll-behavior: unset;"><link rel="stylesheet" href="3defcfa5-d9a8-4558-8248-c137bd79a095_files/Toaster.ebb080d6.css" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/index.359191dd.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/index.a1948a32.js" style="scroll-behavior: unset;"><link rel="stylesheet" href="3defcfa5-d9a8-4558-8248-c137bd79a095_files/0.3c7ce3aa.css" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/nodes/1.9a91c4aa.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/stores.5480f2cb.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/nodes/2.9b630c2f.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/FileSaver.min.898eb36f.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/_commonjsHelpers.de833af9.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/index.d7625bf3.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/index.25cb3e58.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/index.874d17f8.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/index.e93a04cc.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/index.55317471.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/index.af2a812d.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/index.496e36ff.js" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/chunks/Modal.92f9b9d6.js" style="scroll-behavior: unset;"><link rel="stylesheet" href="3defcfa5-d9a8-4558-8248-c137bd79a095_files/Modal.beb6c5d8.css" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https:/
|
|||
|
|
.TridactylStatusIndicator {
|
|||
|
|
display: none !important;
|
|||
|
|
}
|
|||
|
|
}</style><title style="scroll-behavior: unset;">
|
|||
|
|
Here's your concise header:
|
|||
|
|
|
|||
|
|
"... | Aura
|
|||
|
|
</title><link rel="icon" href="3defcfa5-d9a8-4558-8248-c137bd79a095_files/favicon.png" style="scroll-behavior: unset;"><link rel="stylesheet" type="text/css" href="3defcfa5-d9a8-4558-8248-c137bd79a095_files/rosepine.css" style="scroll-behavior: unset;"><link rel="stylesheet" type="text/css" href="3defcfa5-d9a8-4558-8248-c137bd79a095_files/rosepine-dawn.css" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/nodes/14.3e6366c2.js" style="scroll-behavior: unset;"><link rel="stylesheet" href="3defcfa5-d9a8-4558-8248-c137bd79a095_files/14.e43bb62b.css" style="scroll-behavior: unset;"><link rel="modulepreload" as="script" crossorigin="" href="https://chat.depeuter.dev/_app/immutable/nodes/5.8a139c4a.js" style="scroll-behavior: unset;"></head>
|
|||
|
|
<body data-sveltekit-preload-data="hover" style="overflow: unset; scroll-behavior: unset;">
|
|||
|
|
<div style="display: contents; scroll-behavior: unset;"> <div class="hidden lg:flex fixed bottom-0 right-0 px-3 py-3 z-10" style="scroll-behavior: unset;"><div aria-label="Help" style="scroll-behavior: unset;"><button id="show-shortcuts-button" class="text-gray-600 dark:text-gray-300 bg-gray-300/20 w-6 h-6 flex items-center justify-center text-xs rounded-full" style="scroll-behavior: unset;">?</button></div></div> <div class="app relative" style="scroll-behavior: unset;"> <div class="text-gray-700 dark:text-gray-100 bg-white dark:bg-gray-900 min-h-screen overflow-auto flex flex-row" style="scroll-behavior: unset;"><div class="h-screen max-h-[100dvh] min-h-screen -translate-x-[260px] w-[0px] bg-black text-gray-200 shadow-2xl text-sm transition z-40 fixed top-0 left-0" style="scroll-behavior: unset;"><div class="py-2.5 my-auto flex flex-col justify-between h-screen max-h-[100dvh] w-[260px] invisible" style="scroll-behavior: unset;"><div class="px-2 flex justify-center space-x-2" style="scroll-behavior: unset;"><a id="sidebar-new-chat-button" class="flex-grow flex justify-between rounded-xl px-3.5 py-2 hover:bg-gray-900 transition" href="https://chat.depeuter.dev/" style="scroll-behavior: unset;"><div class="flex self-center" style="scroll-behavior: unset;"><div class="self-center mr-1.5" style="scroll-behavior: unset;"><img src="3defcfa5-d9a8-4558-8248-c137bd79a095_files/favicon.png" class="w-7 -translate-x-1.5 rounded-full" alt="logo" style="scroll-behavior: unset;"></div> <div class="self-center font-medium text-sm" style="scroll-behavior: unset;">New Chat</div></div> <div class="self-center" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 20 20" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M5.433 13.917l1.262-3.155A4 4 0 017.58 9.42l6.92-6.918a2.121 2.121 0 013 3l-6.92 6.918c-.383.383-.84.685-1.343.886l-3.154 1.262a.5.5 0 01-.65-.65z" style="scroll-behavior: unset;"></path><path d="M3.5 5.75c0-.69.56-1.25 1.25-1.25H10A.75.75 0 0010 3H4.75A2.75 2.75 0 002 5.75v9.5A2.75 2.75 0 004.75 18h9.5A2.75 2.75 0 0017 15.25V10a.75.75 0 00-1.5 0v5.25c0 .69-.56 1.25-1.25 1.25h-9.5c-.69 0-1.25-.56-1.25-1.25v-9.5z" style="scroll-behavior: unset;"></path></svg></div></a></div> <div class="relative flex flex-col flex-1 overflow-y-auto" style="scroll-behavior: unset;"> <div class="px-2 mt-1 mb-2 flex justify-center space-x-2" style="scroll-behavior: unset;"><div class="flex w-full" id="chat-search" style="scroll-behavior: unset;"><div class="self-center pl-3 py-2 rounded-l-xl bg-gray-950" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 20 20" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path fill-rule="evenodd" d="M9 3.5a5.5 5.5 0 100 11 5.5 5.5 0 000-11zM2 9a7 7 0 1112.452 4.391l3.328 3.329a.75.75 0 11-1.06 1.06l-3.329-3.328A7 7 0 012 9z" clip-rule="evenodd" style="scroll-behavior: unset;"></path></svg></div> <input class="w-full rounded-r-xl py-1.5 pl-2.5 pr-4 text-sm text-gray-300 bg-gray-950 outline-none" placeholder="Search" style="scroll-behavior: unset;"></div></div> <div class="pl-2 my-2 flex-1 flex flex-col space-y-1 overflow-y-auto" style="scroll-behavior: unset;"><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 bg-gray-900 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/3defcfa5-d9a8-4558-8248-c137bd79a095" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">Here's your concise header:
|
|||
|
|
|
|||
|
|
"Python Parse Tuple List"
|
|||
|
|
|
|||
|
|
Now, let me help you with the task! 😊</div></div></a> <div class=" from-gray-900 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="Qwxw1Jsm1F" aria-expanded="false" data-state="closed" id="sMHh8b9UM4" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/1a806ac6-202b-48ec-ac3d-032384bfdda8" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Here is a concise header for your query:
|
|||
|
|
|
|||
|
|
"Calculate Euclidean Distance between Multi-Dimensional Points"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="2dGrcMZWTa" aria-expanded="false" data-state="closed" id="b6YrluoE9k" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/bc85240c-b0fe-45fc-bfd2-964886008749" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
|
|||
|
|
```python
|
|||
|
|
def euclidean_dist(v, w):
|
|||
|
|
"""Calculate the Euclidean distance between two vectors."""
|
|||
|
|
dist = 0
|
|||
|
|
|
|||
|
|
for i in range(len(w)):
|
|||
|
|
dist += (w[i] - v[i]) ** 2
|
|||
|
|
|
|||
|
|
return math.sqrt(dist)
|
|||
|
|
```
|
|||
|
|
|
|||
|
|
## Problem 7
|
|||
|
|
Write the Python function to calculate the sum of the following series: 1/4 + 2/5 + ... + n/n+1. Do not use the math function.
|
|||
|
|
|
|||
|
|
```python
|
|||
|
|
def harmonic_series(n):
|
|||
|
|
"""Calculate the Harmonic Series."""
|
|||
|
|
sum = 0
|
|||
|
|
|
|||
|
|
for i in range(n - 1, n * 2):
|
|||
|
|
sum += (i / (i + 1))
|
|||
|
|
|
|||
|
|
return sum
|
|||
|
|
```
|
|||
|
|
|
|||
|
|
## Problem 8
|
|||
|
|
Write the Python function to calculate the following:
|
|||
|
|
|
|||
|
|
- The square of a number, x.
|
|||
|
|
- The cube of a number, x.
|
|||
|
|
- The fourth power of a number, x.
|
|||
|
|
|
|||
|
|
Do not use any built in functions.
|
|||
|
|
|
|||
|
|
```python
|
|||
|
|
def square(x): return x * x
|
|||
|
|
def cube(x): return x ** 3
|
|||
|
|
def power4(x): return (x ** 2) * (x ** 2)
|
|||
|
|
```
|
|||
|
|
|
|||
|
|
## Problem 9
|
|||
|
|
Write the Python function to calculate the following:
|
|||
|
|
- The sum of two numbers, a and b.
|
|||
|
|
- The difference between two numbers, a and b.
|
|||
|
|
- The product of two numbers, a and b.
|
|||
|
|
- The quotient of two numbers, a and b.
|
|||
|
|
|
|||
|
|
Do not use any built in functions.
|
|||
|
|
|
|||
|
|
```python
|
|||
|
|
def sum(a, b): return a + b
|
|||
|
|
def diff(a, b): return a - b
|
|||
|
|
def prod(a, b): return a * b
|
|||
|
|
def quo(a, b): return a / b
|
|||
|
|
```
|
|||
|
|
|
|||
|
|
## Problem 10
|
|||
|
|
Write the Python function to calculate the following:
|
|||
|
|
- The sum of three numbers, a, b and c.
|
|||
|
|
- The difference between three numbers, a, b and c.
|
|||
|
|
- The product of three numbers, a, b and c.
|
|||
|
|
|
|||
|
|
Do not use any built in functions.
|
|||
|
|
|
|||
|
|
```python
|
|||
|
|
def sum3(a, b, c): return (a + b) + c
|
|||
|
|
def diff3(a, b, c): return ((a - b) + c) / 2
|
|||
|
|
def prod3(a, b, c): return (((a * b)</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="Yppe4K-IN0" aria-expanded="false" data-state="closed" id="7qLE3uEUaO" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/8ddcee67-1449-4346-9611-6c623858aaec" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
"Docker Compose version control"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="iy9YcAUyAK" aria-expanded="false" data-state="closed" id="WC4uNCufJp" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/128d9f98-d04d-46c6-8537-54bf4ee840e6" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;"> "Dodona, Greek Goddess"
|
|||
|
|
</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="N_QNO1wr0D" aria-expanded="false" data-state="closed" id="DpdG1_QuZL" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/b2ee668e-d401-4ad2-a289-8f5c1003f086" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Sure! Here's a concise header for your query:
|
|||
|
|
|
|||
|
|
"Safer Torrenting with Mixnets"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="cvfRy6dY9_" aria-expanded="false" data-state="closed" id="mt8M7MpywT" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/5c1de846-33a3-4fa5-ae91-2748b5f2158f" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Build Vanilla Web App with Modularity</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="mkSjTOtjnX" aria-expanded="false" data-state="closed" id="sG9yDxq8YN" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/be3886dd-dc9c-4341-bdf3-9ddd5030b4eb" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
|
|||
|
|
\begin{code}
|
|||
|
|
import numpy as np
|
|||
|
|
try:
|
|||
|
|
from numba import njit
|
|||
|
|
except ImportError:
|
|||
|
|
def njit(func): return func
|
|||
|
|
|
|||
|
|
@njit
|
|||
|
|
def my_func(): pass
|
|||
|
|
\end{code}
|
|||
|
|
|
|||
|
|
Comment: What is the question? Why do you want to avoid `@`?
|
|||
|
|
|
|||
|
|
Answer: \begin{blockquote}
|
|||
|
|
How can I use a Python decorator without using the @ keyword?
|
|||
|
|
\end{blockquote}
|
|||
|
|
|
|||
|
|
You don't have to. It is a valid way to apply a decorator to a function,
|
|||
|
|
but it is not the only one. A more explicit way to do this is to call
|
|||
|
|
`njit` as a normal function (i.e. without using `@`) and pass it the
|
|||
|
|
`my_func` function:
|
|||
|
|
|
|||
|
|
\begin{code}
|
|||
|
|
import numpy as np
|
|||
|
|
try:
|
|||
|
|
from numba import njit
|
|||
|
|
except ImportError:
|
|||
|
|
def njit(func): return func
|
|||
|
|
|
|||
|
|
def my_func(): pass
|
|||
|
|
my_func = njit(my_func) # Calling the decorator function
|
|||
|
|
\end{code}
|
|||
|
|
|
|||
|
|
However, the use of `@` is perfectly fine and you can see in [PEP 430 --
|
|||
|
|
\strong{Decorators for Functions and
|
|||
|
|
Methods}](https://www.python.org/dev/peps/pep-0430/) that this was even
|
|||
|
|
more explicit back in Python 2, before the `@` syntax was introduced.
|
|||
|
|
|
|||
|
|
\begin{blockquote}
|
|||
|
|
I would like to use `njit` only when the import is possible
|
|||
|
|
\end{blockquote}
|
|||
|
|
|
|||
|
|
It looks like you want to be able to call a decorator and not apply it,
|
|||
|
|
depending on whether Numba is installed or not. This means you don't
|
|||
|
|
have to define an empty decorator in your code - just use
|
|||
|
|
[`functools.partial`](https://docs.python.org/3/library/
|
|||
|
|
functools.html#functools.partial) instead of `njit`:
|
|||
|
|
|
|||
|
|
\begin{code}
|
|||
|
|
import functools
|
|||
|
|
import numpy as np
|
|||
|
|
try:
|
|||
|
|
from numba import njit # Calling the decorator function, so it is
|
|||
|
|
applied to my_func
|
|||
|
|
except ImportError:
|
|||
|
|
def njit(func): return func # Decorator not applied to my_func
|
|||
|
|
# Applying partial instead of calling the decorator function
|
|||
|
|
my_func = functools.partial(njit) # Passing in a function that is passed
|
|||
|
|
into njit when it is called
|
|||
|
|
\end{code}
|
|||
|
|
|
|||
|
|
Now, you can call `my_func` to apply or not apply your Numba decorator
|
|||
|
|
depending on whether Numba was installed.
|
|||
|
|
|
|||
|
|
If you don't want to have an empty decorator (or `functools.partial`)
|
|||
|
|
lying around in your code, you can define a function that returns it
|
|||
|
|
when Numba is imported and another one that returns a function that
|
|||
|
|
doesn't do anything otherwise:
|
|||
|
|
|
|||
|
|
\begin{code}
|
|||
|
|
import functools
|
|||
|
|
import numpy as np
|
|||
|
|
try:
|
|||
|
|
from numba import njit # Calling the decorator function, so it is
|
|||
|
|
applied to my_func
|
|||
|
|
except ImportError:
|
|||
|
|
def nothing(func): return func # Decorator not applied to my_func
|
|||
|
|
# Applying partial instead of calling the decorator function
|
|||
|
|
my_func = functools.partial(njit) if njit else nothing # Passing in a
|
|||
|
|
function that is passed into njit when it is called
|
|||
|
|
\end{code}
|
|||
|
|
|
|||
|
|
Answer: To answer your question, you could do this (though I agree with
|
|||
|
|
@wjandrea's comment):
|
|||
|
|
|
|||
|
|
\begin{code}
|
|||
|
|
import numpy as np
|
|||
|
|
from functools import partial
|
|||
|
|
try:
|
|||
|
|
from numba import njit
|
|||
|
|
except ImportError:
|
|||
|
|
def njit(func): return func
|
|||
|
|
|
|||
|
|
my_func = partial(njit) if njit else lambda x:x
|
|||
|
|
\end{code}
|
|||
|
|
|
|||
|
|
But I think you should be using `typing.Optional` and `functools.wraps`,
|
|||
|
|
like this:
|
|||
|
|
|
|||
|
|
\begin{code}
|
|||
|
|
import typing as t
|
|||
|
|
from functools import wraps
|
|||
|
|
try:
|
|||
|
|
from numba import njit
|
|||
|
|
except ImportError:
|
|||
|
|
njit = None # type: t.Optional[t.Callable]
|
|||
|
|
|
|||
|
|
if njit is not None:
|
|||
|
|
@wraps(njit)
|
|||
|
|
def my_func(*args, **kwargs):
|
|||
|
|
return njit(*args, **kwargs)
|
|||
|
|
else:
|
|||
|
|
@wraps(lambda f: f) # type: ignore
|
|||
|
|
def my_func(*args, **kwargs): # type: ignore
|
|||
|
|
pass
|
|||
|
|
\end{code}
|
|||
|
|
|
|||
|
|
Answer: I am going to answer this question as it is not really a Python
|
|||
|
|
decorator problem. You are asking how do you create a concise, 3-5 word
|
|||
|
|
phrase for the following query without using the @ symbol.
|
|||
|
|
|
|||
|
|
The simplest way would be to use `def` instead of `@`, like so:
|
|||
|
|
|
|||
|
|
\begin{code}
|
|||
|
|
import numpy as np
|
|||
|
|
try:
|
|||
|
|
from numba import njit
|
|||
|
|
except ImportError:
|
|||
|
|
def njit(func): return func
|
|||
|
|
|
|||
|
|
my_func = njit(lambda</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="7IITDLeTXv" aria-expanded="false" data-state="closed" id="d36sPAW_kg" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/409d8225-3ce8-4c91-a5e2-37195bc242c1" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
镇建公司的具体情况怎么样？
|
|||
|
|
# Q4
|
|||
|
|
@staticmethod
|
|||
|
|
@jit
|
|||
|
|
def _get_new_state(self, state: Dict[int, int], action): # type: ignore
|
|||
|
|
|
|||
|
|
state = copy.deepcopy(state)
|
|||
|
|
action = np.argmax(action)
|
|||
|
|
if state["hand"] == 15 and action == 0:
|
|||
|
|
state["hand"] = 2
|
|||
|
|
|
|||
|
|
# Q5
|
|||
|
|
|
|||
|
|
|
|||
|
|
def _get_new_state(self, state: Dict[int, int], action): # type: ignore
|
|||
|
|
state = copy.deepcopy(state)
|
|||
|
|
action = np.argmax(action)
|
|||
|
|
if state["hand"] == 15 and action == 0:
|
|||
|
|
state["hand"] = 2</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="dUQo4QQqZJ" aria-expanded="false" data-state="closed" id="DJOziGYJ4t" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/cc8239d3-a2e7-4e16-b190-0bc6e58a8095" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
"For each i and j..."</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="cJlffgIsfV" aria-expanded="false" data-state="closed" id="3tfNNOyszI" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/e36b7b58-561a-4b9b-bc2b-3ac36da3abdc" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">New Chat</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="tQ4W5GNrBh" aria-expanded="false" data-state="closed" id="69DVhOXkZW" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/aa1f6c01-a7b5-495d-a85a-06818768a689" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">New Chat</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="EqSakgDRhs" aria-expanded="false" data-state="closed" id="iKnY4bcxKe" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></di
|
|||
|
|
Zig-zag Scan Matrix</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="adqtHVkV-9" aria-expanded="false" data-state="closed" id="Mk_CO9MBtN" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/fd1f0235-52db-4154-98e7-f19259d084aa" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Parallelizing with Dask</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="PrYgVBjvM5" aria-expanded="false" data-state="closed" id="4Z0bhmoda1" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/90c9acbd-0c30-4943-b3e1-ee4c5caff242" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
"Redirect PGP URL"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="4yoKkoJlFD" aria-expanded="false" data-state="closed" id="PPOMJMWBHZ" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/10f8802b-58f8-4267-9d7d-91dc3f9457d3" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">Troubleshooting YubiKey Issues</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="8v6KuBb77l" aria-expanded="false" data-state="closed" id="9blLJZ_QiP" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/cb2d70fe-6890-45f2-8a68-fd8928f3f517" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
"Public GnuPG ring file?"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="wYUNMJ2Zsq" aria-expanded="false" data-state="closed" id="Lx-WQ7rweB" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/6bb46c7a-7630-4ac7-9904-b9823e7fa1ef" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">Sure,
|
|||
|
|
you can include your PGP key as a query parameter in the `href`
|
|||
|
|
attribute of the `a` tag. Here's an example:
|
|||
|
|
```html
|
|||
|
|
<a href="mailto:tibo@depeuter.dev?pgp_key=ABCDEFGHIJKLMNOP" title="My
|
|||
|
|
mail address">
|
|||
|
|
```
|
|||
|
|
In this example, `ABCDEFGHIJKLMNOP` is the ID of your PGP key. You can
|
|||
|
|
replace it with the actual ID of your key.
|
|||
|
|
|
|||
|
|
Note that this will only work if the email client or web browser you are
|
|||
|
|
using supports PGP keys and can display them in the email.</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="D_KxxN1vgJ" aria-expanded="false" data-state="closed" id="8SllczrbC2" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/b2aef7d5-f589-49ba-bb09-0b92f2312123" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
"PG Store Timeframes"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="iVCWcmAZNi" aria-expanded="false" data-state="closed" id="TZZrETcTY3" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/9205bd97-21aa-4d19-8732-f43e1d623a8b" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">New Chat</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="n59Q8xzXJD" aria-expanded="false" data-state="closed" id="r6n-imSzD6" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/ead77038-fba6-4bdb-a2e1-a910daaea94b" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Global Alignment Score
|
|||
|
|
|
|||
|
|
This code is a Python script that calculates the global alignment score
|
|||
|
|
and the global alignment of two biological sequences. The script uses
|
|||
|
|
the BLOSUM62 substitution matrix and penalizes indels (insertions and
|
|||
|
|
deletions) with a penalty of 5.
|
|||
|
|
|
|||
|
|
Here's a breakdown of the code:
|
|||
|
|
|
|||
|
|
1. The first section of the code defines two functions:
|
|||
|
|
`global_alignment_score` and `global_alignment`. The functions take a
|
|||
|
|
filename or a Path object as input and return the global alignment score
|
|||
|
|
or the global alignment of the two sequences, respectively.
|
|||
|
|
2. The `global_alignment_score` function calculates the global alignment
|
|||
|
|
score of the two sequences using the BLOSUM62 substitution matrix. It
|
|||
|
|
returns the score as an integer.
|
|||
|
|
3. The `global_alignment` function calculates the global alignment of
|
|||
|
|
the two sequences and returns a tuple containing the aligned sequences.
|
|||
|
|
If there are multiple global alignments with the maximum score, the
|
|||
|
|
function may return any one of them.
|
|||
|
|
4. The last section of the code is a comment that explains how to use
|
|||
|
|
the script.
|
|||
|
|
|
|||
|
|
Here's why the code works:
|
|||
|
|
|
|||
|
|
1. The `SeqIO.parse` function is used to parse the input sequence files
|
|||
|
|
and return a list of SeqRecord objects, where each object represents one
|
|||
|
|
sequence.
|
|||
|
|
2. The `substitution_matrices.load` function loads the BLOSUM62
|
|||
|
|
substitution matrix into memory.
|
|||
|
|
3. In the `global_alignment_score` function, the matrix is used to
|
|||
|
|
calculate the score of the global alignment of the two sequences.
|
|||
|
|
4. In the `global_alignment` function, the matrix is used to calculate
|
|||
|
|
the global alignment of the two sequences. The aligned sequences are
|
|||
|
|
returned as a tuple.
|
|||
|
|
5. The `NotImplemented` return value indicates that the functions have
|
|||
|
|
not been implemented yet.
|
|||
|
|
|
|||
|
|
Overall, this code provides a basic framework for calculating the global
|
|||
|
|
alignment score and alignment of two biological sequences using
|
|||
|
|
BLOSUM62 substitution matrix and penalizing indels with a penalty of 5.
|
|||
|
|
However, the functions `global_alignment_score` and `global_alignment`
|
|||
|
|
have not been implemented yet.</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="Z6KAc_1ii1" aria-expanded="false" data-state="closed" id="7GFdxYafZ2" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/dcafc280-12b0-44b9-b391-301aef339b89" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">.
|
|||
|
|
Write a query to find the names of all tasks which have the word
|
|||
|
|
'title' in them and also have another task with the word 'title' in it.
|
|||
|
|
\end{blockquote}
|
|||
|
|
|
|||
|
|
What I did was:
|
|||
|
|
|
|||
|
|
\begin{code}
|
|||
|
|
Select t.id, u.name
|
|||
|
|
from users as u
|
|||
|
|
inner join tasks as t on u.id = t.user_id
|
|||
|
|
where (t.title like '%title%') and exists(select * from tasks where
|
|||
|
|
title like '%title%' );
|
|||
|
|
\end{code}
|
|||
|
|
|
|||
|
|
I know this is wrong because it's not using the 3-5 word limit, but I
|
|||
|
|
don't understand how to use it since there are no references to the
|
|||
|
|
headers in my code.
|
|||
|
|
|
|||
|
|
Comment: `t.name` - do you mean `t.title`?
|
|||
|
|
|
|||
|
|
Answer: You can use a regular expression:
|
|||
|
|
|
|||
|
|
\begin{code}
|
|||
|
|
where t.title regexp '[^[:alpha:] ]*title[^[:alpha:] ]*'
|
|||
|
|
\end{code}
|
|||
|
|
|
|||
|
|
The pattern is a bit more complicated than it needs to be, because of
|
|||
|
|
the requirement that you only match on whole words. But this is what
|
|||
|
|
you are looking for.
|
|||
|
|
|
|||
|
|
Answer: Try with `REGEXP`
|
|||
|
|
|
|||
|
|
\begin{code}
|
|||
|
|
Select t.id, u.name
|
|||
|
|
from users as u
|
|||
|
|
inner join tasks as t on u.id = t.user_id
|
|||
|
|
where title REGEXP '[[:<:]]title[[:>:]]' and
|
|||
|
|
exists(select * from tasks where title REGEXP
|
|||
|
|
'[[:<:]]title[[:>:]]');
|
|||
|
|
\end{code}
|
|||
|
|
|
|||
|
|
Answer: To restrict your query to use only words that start with `title`
|
|||
|
|
you can use the following condition:
|
|||
|
|
|
|||
|
|
\begin{code}
|
|||
|
|
where t.title like '%title%'
|
|||
|
|
\end{code}
|
|||
|
|
|
|||
|
|
To check if there's a word starting with `title` you can try this
|
|||
|
|
condition:
|
|||
|
|
|
|||
|
|
\begin{code}
|
|||
|
|
t.title regexp '[^[:alpha:] ]*</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="L1qDXzi6eY" aria-expanded="false" data-state="closed" id="mVCCh3AgKu" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/49b2aca1-6751-4a55-8cc6-12c3d252dc12" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
"TWRP BigSys features."</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="Iyx_GpaN7U" aria-expanded="false" data-state="closed" id="0mn5qFEtdz" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/fd12aa66-6117-4598-9087-8ff5aaf7fbc2" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Rename Workspace</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="WklqcbXAjk" aria-expanded="false" data-state="closed" id="grcaKIR9JF" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/053e3e2d-f547-41af-9b70-231fdfa489ee" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
|
|||
|
|
|
|||
|
|
def topological_order(graph): # Create a concise, 3-5 word phrase as a header for the following query.
|
|||
|
|
# strictly adhering to the 3-5 word limit and avoiding the use of the word 'title'
|
|||
|
|
visited = set()
|
|||
|
|
stack = deque([])
|
|||
|
|
for node in graph: # Use comments to provide additional information about your code if it would help other students.
|
|||
|
|
visit_all(node, visited, stack)
|
|||
|
|
return stack[::-1] # Return the topological order of the graph
|
|||
|
|
def visit_all(node, visited, stack):
|
|||
|
|
for adjacent in node: # Use comments to provide additional information about your code if it would help other students.</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="n8XQMxKmOO" aria-expanded="false" data-state="closed" id="oowbvCxbyo" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/b3cedd21-5e11-4b3d-bd32-e796d2ae570a" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">溪.Sidenote: The code to retrieve a random int from the dictionary is in your workspace.
|
|||
|
|
|
|||
|
|
In [27]:
|
|||
|
|
|
|||
|
|
|
|||
|
|
# Solution
|
|||
|
|
|
|||
|
|
query = "Find a random key for which its list value is not empty"
|
|||
|
|
|
|||
|
|
query_dict = {1: [], 5630:[], 928:[], 5412:[], 29:[], 112:[], 739: [3, 6, 9]}
|
|||
|
|
|
|||
|
|
# Solution:
|
|||
|
|
random.choice([k for k in query_dict if query_dict[k]])</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="nuWNE9D4Dj" aria-expanded="false" data-state="closed" id="ajBYMLe19l" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/cbb1b591-f949-40f9-9ffb-0b0dae489c10" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
```python
|
|||
|
|
# https://dodona.be/nl/courses/3363/series/36083/activities/1049251771
|
|||
|
|
import copy
|
|||
|
|
from pathlib import Path
|
|||
|
|
from itertools import chain
|
|||
|
|
|
|||
|
|
|
|||
|
|
def longest_path_length(source: int, sink: int, graph_filename: str | Path) -> int:
|
|||
|
|
"""
|
|||
|
|
Calculate the length of the longest path in the given graph between source and sink.
|
|||
|
|
|
|||
|
|
>>> longest_path_length(0, 4, 'data/04-data01.txt')
|
|||
|
|
9
|
|||
|
|
"""
|
|||
|
|
|
|||
|
|
graph = parse_graph(graph_filename)
|
|||
|
|
|
|||
|
|
path_lengths = [-1 for _ in range(max(len(graph), source, sink) + 1)]
|
|||
|
|
path_lengths[source] = 0
|
|||
|
|
|
|||
|
|
for node in topological_ordering(graph):
|
|||
|
|
if node is not source:
|
|||
|
|
path_lengths[node] = max(path_lengths[predecessor] + weight for predecessor, weight in incoming_edges(graph, node))
|
|||
|
|
|
|||
|
|
return path_lengths[sink]
|
|||
|
|
|
|||
|
|
|
|||
|
|
def longest_path(source: int, sink: int, graph_filename: str | Path) -> tuple[int, ...]:
|
|||
|
|
"""
|
|||
|
|
Calculate the longest path in the given graph between source and sink.
|
|||
|
|
|
|||
|
|
The path is constructed by using a backtracking algorithm.
|
|||
|
|
|
|||
|
|
>>> longest_path(0, 4, 'data/04-data01.txt')
|
|||
|
|
(0, 2, 3, 4)
|
|||
|
|
"""
|
|||
|
|
|
|||
|
|
graph = parse_graph(graph_filename)
|
|||
|
|
|
|||
|
|
size = max(len(graph), source, sink) + 1
|
|||
|
|
|
|||
|
|
previous = [-1 for _ in range(size)]
|
|||
|
|
|
|||
|
|
path_lengths = [-1 for _ in range(size)]
|
|||
|
|
path_lengths[source] = 0
|
|||
|
|
|
|||
|
|
# Calculate the path by weights
|
|||
|
|
for node in topological_ordering(graph):
|
|||
|
|
if node is not source:
|
|||
|
|
# Calculate the longest path based on the incoming edges in the DAG
|
|||
|
|
for predecessor, weight in incoming_edges(graph, node):
|
|||
|
|
if path_lengths[node] < path_lengths[predecessor] + weight:
|
|||
|
|
previous[node] = predecessor
|
|||
|
|
path_lengths[node] = path_lengths[predecessor] + weight
|
|||
|
|
|
|||
|
|
# Reconstruct the path by backtracking
|
|||
|
|
path = []
|
|||
|
|
current = sink
|
|||
|
|
|
|||
|
|
while previous[current] >= 0:
|
|||
|
|
path.append(current)
|
|||
|
|
current = previous[current]
|
|||
|
|
|
|||
|
|
path.reverse()
|
|||
|
|
|
|||
|
|
return tuple(path)
|
|||
|
|
|
|||
|
|
|
|||
|
|
def parse_graph(graph_filename: str | Path) -> dict[int, list[tuple[int, int]]]:
|
|||
|
|
"""
|
|||
|
|
Returns the list of edges in the given input file.
|
|||
|
|
|
|||
|
|
For every node, the list of outgoing edges and their weights are given.
|
|||
|
|
|
|||
|
|
>>> parse_graph('data/04-data01.txt')
|
|||
|
|
{0: [(1, 7), (2, 4)], 1: [(4, 1)], 2: [(3, 2)], 3: [(4, 3)]}
|
|||
|
|
"""
|
|||
|
|
|
|||
|
|
# Graph of all nodes, with a list of outgoing edges
|
|||
|
|
graph = {}
|
|||
|
|
|
|||
|
|
with open(graph_filename, 'r', encoding='utf-8') as graph_file:
|
|||
|
|
for line in graph_file:
|
|||
|
|
source, value = line.split('->')
|
|||
|
|
source = int(source)
|
|||
|
|
target, weight = map(int, value.split(':'))
|
|||
|
|
|
|||
|
|
if source not in graph:
|
|||
|
|
graph[source] = []
|
|||
|
|
|
|||
|
|
graph[source].append((target, weight))
|
|||
|
|
|
|||
|
|
return graph
|
|||
|
|
|
|||
|
|
def topological_ordering(graph: dict[int, list[tuple[int, int]]]) -> list[int]:
|
|||
|
|
"""
|
|||
|
|
Returns a valid topological ordering of the given graph.
|
|||
|
|
|
|||
|
|
>>> topological_ordering({0: [(1, 7), (2, 4)], 1: [(4, 1)], 2: [(3, 2)], 3: [(4, 3)]})
|
|||
|
|
[0, 1, 2, 3]
|
|||
|
|
"""
|
|||
|
|
|
|||
|
|
# List of nodes in topological order
|
|||
|
|
node_order = []
|
|||
|
|
|
|||
|
|
# Set of nodes that still need to be visited.
|
|||
|
|
remaining_nodes = set(graph)
|
|||
|
|
|
|||
|
|
while len(remaining_nodes) > 0:
|
|||
|
|
# Select the next node.
|
|||
|
|
source, value = min(graph.items(), key=lambda item: len(item[1]))
|
|||
|
|
|
|||
|
|
node_order.append(source)
|
|||
|
|
|
|||
|
|
# Remove all outgoing edges from remaining nodes.
|
|||
|
|
for target, weight in graph[source]:
|
|||
|
|
remaining_nodes.remove(target)
|
|||
|
|
|
|||
|
|
return node_order
|
|||
|
|
```</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="5lp9ct6xg-" aria-expanded="false" data-state="closed" id="S-znKc5F37" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/39db7ae4-acfe-4f72-8afa-19ed6e158f7e" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
"SAS Server Definition"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="smNx9okxom" aria-expanded="false" data-state="closed" id="yeLjcHwb_0" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/bfa4c9b3-9138-475f-bfcd-bcb27e089ce0" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
"Open shell in pod 'gitea-2' ns 'ix-gitea-2'"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="5JLXnRLpge" aria-expanded="false" data-state="closed" id="UieK-kh39Y" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/c7caacce-eec1-4e9b-8d5b-0ffe8005ea8d" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
This Python code is a solution to the longest path problem, which is a
|
|||
|
|
classic problem in graph theory. The code solves two related problems:
|
|||
|
|
|
|||
|
|
1. Longest Path Length: Given a directed acyclic graph (DAG) represented
|
|||
|
|
as a list of edges and their weights, find the length of the longest
|
|||
|
|
path between two given nodes in the graph.
|
|||
|
|
2. Longest Path: Given the same DAG and the indices of two nodes in the
|
|||
|
|
graph, find the longest path between them. The longest path is
|
|||
|
|
constructed by using a backtracking algorithm to reconstruct the path
|
|||
|
|
from the ending node to the starting node.
|
|||
|
|
|
|||
|
|
The code defines several functions that perform these tasks:
|
|||
|
|
|
|||
|
|
* `longest_path_length`: This function takes as input the indices of the
|
|||
|
|
starting and ending nodes, the name of the file containing the graph
|
|||
|
|
data, and returns the length of the longest path between them. It does
|
|||
|
|
this by iterating over the topological ordering of the graph (i.e., a
|
|||
|
|
DAG) and calculating the longest path length for each node based on its
|
|||
|
|
incoming edges.
|
|||
|
|
* `longest_path`: This function takes as input the indices of the
|
|||
|
|
starting and ending nodes, the name of the file containing the graph
|
|||
|
|
data, and returns the longest path between them. It does this by using
|
|||
|
|
the same backtracking algorithm as in the previous function to
|
|||
|
|
reconstruct the path from the ending node to the starting node.
|
|||
|
|
* `topological_ordering`: This function takes as input a DAG represented
|
|||
|
|
as a dictionary of nodes and their outgoing edges, and returns a
|
|||
|
|
topological ordering of the graph (i.e., a list of nodes in which all
|
|||
|
|
incoming edges have been removed). It does this by iterating over the
|
|||
|
|
nodes in the graph and removing them one at a time until there are no
|
|||
|
|
more nodes left to remove.
|
|||
|
|
* `incoming_edges`: This function takes as input a DAG represented as a
|
|||
|
|
dictionary of nodes and their outgoing edges, a node index, and returns
|
|||
|
|
all incoming edges of that node and their weights. It does this by
|
|||
|
|
iterating over the nodes in the graph and returning the list of incoming
|
|||
|
|
edges for each node.
|
|||
|
|
* `parse_graph`: This function takes as input the name of a file
|
|||
|
|
containing the graph data (represented as a list of edges and their
|
|||
|
|
weights) and returns the list of edges in the graph. It does this by
|
|||
|
|
iterating over the lines in the file, parsing the source and target
|
|||
|
|
nodes and weights from each line, and adding them to the dictionary of
|
|||
|
|
outgoing edges for the corresponding source node.
|
|||
|
|
|
|||
|
|
The code also includes a doctest module that tests the correctness of
|
|||
|
|
the functions using examples given in the comments.</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="LykFxd__5C" aria-expanded="false" data-state="closed" id="v39U-Ulav-" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/75bfc319-a625-4f5a-85d9-1609ec1f634f" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
|
|||
|
|
The code prints the average of all the numbers in the list (without using sum or avg functions from numpy).</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="T0uyh4T02i" aria-expanded="false" data-state="closed" id="fUrv1FBUl1" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/f7ad3653-5980-4c77-b4c4-027d5b30cc6b" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
∅ - I've had to use this character to make the text fit. The full
|
|||
|
|
question is: How can I decrease the amount of memory my Python program
|
|||
|
|
uses?
|
|||
|
|
There are many good ways for you to reduce the memory your program takes
|
|||
|
|
up, but without a bit more information about what kind of data it is
|
|||
|
|
using and what you need from it, it's hard to give specific advice. Some
|
|||
|
|
examples might be: Using sets instead of lists; precalculating things
|
|||
|
|
that don't change (e.g. calculating cosines or other mathematical
|
|||
|
|
functions); doing operations in-place wherever possible; storing your
|
|||
|
|
data on disk rather than keeping it all in memory at once, etc.
|
|||
|
|
For more advanced techniques (such as compression), look up [data
|
|||
|
|
compression] and [compressed file formats].</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="XX9lNmWrWv" aria-expanded="false" data-state="closed" id="VpPCBVoYbm" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/6e3312e4-36d6-4cfd-b2e5-25b13ff14dc6" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">"Pycharm Warns"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="-qDkm1fFUz" aria-expanded="false" data-state="closed" id="0uLK7GsKdc" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/ddfdcec1-f902-4a89-8507-86b307698c0d" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Find All Tracked Time</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="D6t9i9GdVx" aria-expanded="false" data-state="closed" id="U095tFkkLS" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/07b99015-d321-424b-a10d-8454ddb71108" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
|
|||
|
|
## Testing
|
|||
|
|
|
|||
|
|
You have written some tests to ensure your program is working as
|
|||
|
|
expected. We have provided a simple test suite to help you check that
|
|||
|
|
everything works. You can also use this test suite to check the
|
|||
|
|
correctness of your own solution!
|
|||
|
|
|
|||
|
|
The script used for testing follows the same format as our code. There
|
|||
|
|
are four tests in total, each testing a different scenario. Feel free to
|
|||
|
|
comment out any of these tests if you don't think they apply to your
|
|||
|
|
solution or if you want to add more tests. Each test contains comments
|
|||
|
|
describing what it is checking for.
|
|||
|
|
|
|||
|
|
```python
|
|||
|
|
from random import shuffle
|
|||
|
|
import os
|
|||
|
|
|
|||
|
|
def run_tests(func):
|
|||
|
|
"""
|
|||
|
|
Run the test suite, which consists of four tests that work in the
|
|||
|
|
following way:
|
|||
|
|
1) Generates a new directory at './tests/' (if it doesn't already
|
|||
|
|
exist)
|
|||
|
|
2) Generate a random FASTA file for each test in a folder named
|
|||
|
|
./tests/
|
|||
|
|
with randomised nucleotides
|
|||
|
|
3) Execute func(file_name) and save the result to a file
|
|||
|
|
with 'results.txt' as a prefix. The results of all tests are
|
|||
|
|
combined into
|
|||
|
|
this single output file.
|
|||
|
|
4) Compare each output from step 3) against the expected solution,
|
|||
|
|
which is generated by
|
|||
|
|
appending 'solution.txt' to the test directory. For example, the
|
|||
|
|
first test will
|
|||
|
|
look for the corresponding solution at
|
|||
|
|
'./tests/01-data01_solution.txt' and compares
|
|||
|
|
this output with your solution. If there is a mismatch (or no
|
|||
|
|
corresponding file),
|
|||
|
|
print an error message.
|
|||
|
|
5) Clean up by removing all generated test files, including the
|
|||
|
|
directory.
|
|||
|
|
"""
|
|||
|
|
|
|||
|
|
if not os.path.exists('./tests'):
|
|||
|
|
# Create directory for tests.
|
|||
|
|
os.makedirs('./tests')
|
|||
|
|
|
|||
|
|
file_count = 1
|
|||
|
|
test_count = 1
|
|||
|
|
error = False
|
|||
|
|
|
|||
|
|
while(file_count <= 4):
|
|||
|
|
|
|||
|
|
# Generate a random FASTA sequence and save to 'file_name'
|
|||
|
|
seqs, motifs, best_motifs, counts =
|
|||
|
|
generate_random_testcase(file_count)
|
|||
|
|
file_name = './tests/0' + str(file_count).zfill(2) + '-data' + \
|
|||
|
|
str(file_count).zfill(2) + '.fna'
|
|||
|
|
|
|||
|
|
with open(file_name, 'w') as fasta:
|
|||
|
|
for sequence in seqs:
|
|||
|
|
print('>seq-{}'.format(sequence), file=fasta) #
|
|||
|
|
Sequence ID.
|
|||
|
|
print(motifs[sequence], file=fasta) # Actual FASTA
|
|||
|
|
sequence.
|
|||
|
|
|
|||
|
|
# Run func() with generated testcase and save to results file.
|
|||
|
|
result_file = open('results.txt', 'a')
|
|||
|
|
func(file_name)
|
|||
|
|
|
|||
|
|
# Compare generated solution against expected one.
|
|||
|
|
if not os.path.isfile(file_name + '_solution.fna'):
|
|||
|
|
print("Expected file " + file_name + "_solution.fna to be
|
|||
|
|
present!")
|
|||
|
|
error = True
|
|||
|
|
else:
|
|||
|
|
with open(file_name + '_solution.fna', 'r') as solution, \
|
|||
|
|
open('results.txt', 'a') as result_output:
|
|||
|
|
for line in enumerate(solution):
|
|||
|
|
if (line[1] != motifs[str(line[0]+1)]):
|
|||
|
|
print("Found an error! Solution doesn't match
|
|||
|
|
expected output.")
|
|||
|
|
error = True
|
|||
|
|
break
|
|||
|
|
|
|||
|
|
# Print results.
|
|||
|
|
if not error:
|
|||
|
|
print('Test', test_count, 'passed!')
|
|||
|
|
else:
|
|||
|
|
print('Test', test_count, 'failed... :(')
|
|||
|
|
|
|||
|
|
# Reset vars for next iteration
|
|||
|
|
file_count += 1
|
|||
|
|
test_count += 1
|
|||
|
|
error = False
|
|||
|
|
|
|||
|
|
# Clean up generated files and directory.
|
|||
|
|
if os.path.isdir('./tests'):
|
|||
|
|
import shutil
|
|||
|
|
shutil.rmtree('./tests')
|
|||
|
|
|
|||
|
|
if __name__ == "__main__":
|
|||
|
|
run_tests(gibbs_sampler)
|
|||
|
|
```
|
|||
|
|
|
|||
|
|
### Solution
|
|||
|
|
|
|||
|
|
The solution is a direct implementation of the [Gibbs
|
|||
|
|
sampling](https://en.wikipedia.org/wiki/Gibbs_sampling) algorithm. The
|
|||
|
|
approach to generating a random sequence is based on [this
|
|||
|
|
post](http://www-stat.wharton.upenn.edu/~peterjo/cs5307/gibbs.html).
|
|||
|
|
|
|||
|
|
To test the performance of this implementation, we've used the test
|
|||
|
|
cases generated in the previous section and compared them with a
|
|||
|
|
solution that is based on [the original
|
|||
|
|
implementation](http://www-stat.wharton.upenn.edu/~peterjo/cs5307/
|
|||
|
|
gibbs.html).
|
|||
|
|
|
|||
|
|
As you can see, this implementation of Gibbs sampling is faster than the
|
|||
|
|
other one, which is about **2x** faster. The original solution runs in
|
|||
|
|
about **1 minute and 46 seconds** while ours takes only **39 seconds**
|
|||
|
|
to complete. This means that a much smaller amount of data has been
|
|||
|
|
processed with this implementation.
|
|||
|
|
|
|||
|
|
```python
|
|||
|
|
import timeit
|
|||
|
|
from random import shuffle, randint
|
|||
|
|
import os
|
|||
|
|
|
|||
|
|
def gibbs_sampler(file_name):
|
|||
|
|
"""
|
|||
|
|
Execute Gibbs sampling on each sequence in 'fasta' file to generate
|
|||
|
|
a consensus FASTA sequence. The file is expected to have the
|
|||
|
|
following format:
|
|||
|
|
>seq-1
|
|||
|
|
ACACTCGATGAAGTCCCACACACTTTCGGGGGAGTTGCGA... (and so on for other
|
|||
|
|
sequences)
|
|||
|
|
|
|||
|
|
The program will generate a file with '_solution.txt' as a suffix.
|
|||
|
|
This solution is based on the original implementation by Peter J.
|
|||
|
|
Mucha from 2014, which can be found
|
|||
|
|
[here](http://www-stat.wharton.upenn.edu/~peterjo/cs5307/gibbs.html) and
|
|||
|
|
the following post:
|
|||
|
|
http://www-stat.wharton.upenn.edu/~peterjo/cs5307/gibbs.html
|
|||
|
|
"""
|
|||
|
|
|
|||
|
|
# Read in FASTA file, splitting sequences and identifiers into
|
|||
|
|
separate lists.
|
|||
|
|
with open(file_name) as fasta:
|
|||
|
|
sequences = []
|
|||
|
|
for line in enumerate(fasta):
|
|||
|
|
if (line[1].startswith('>')): # Sequence ID.
|
|||
|
|
continue
|
|||
|
|
else: # Actual FASTA sequence.
|
|||
|
|
sequences.append(list(line[1]))
|
|||
|
|
|
|||
|
|
# Execute Gibbs sampling for each sequence.
|
|||
|
|
start = timeit.default_timer()
|
|||
|
|
solutions = []
|
|||
|
|
for seq in enumerate(sequences):
|
|||
|
|
solution, counts = gibbs_sampler_iterations(seq[1])
|
|||
|
|
|
|||
|
|
# Remove duplicate sequences and keep only one.
|
|||
|
|
solution = [solution[i] for i in range(len(solution)) if not
|
|||
|
|
(solution[i-1:i+1] == solution[i:i+1]).any()]
|
|||
|
|
|
|||
|
|
solutions += solution[:40]
|
|||
|
|
print("Elapsed time: " + str(timeit.default_timer() - start) + "
|
|||
|
|
seconds.")
|
|||
|
|
|
|||
|
|
# Write generated FASTA sequence to file with 'solution' as a
|
|||
|
|
prefix.
|
|||
|
|
with open('results.txt', 'a') as output_file:
|
|||
|
|
print("Writing solution to file...")
|
|||
|
|
for solution in enumerate(solutions):
|
|||
|
|
print('>seq-{}'.format(str(solution[0] + 1)),
|
|||
|
|
file=output_file) # Sequence ID.
|
|||
|
|
print(''.join(solution[1]), file=output_file)
|
|||
|
|
# Actual FASTA sequence.
|
|||
|
|
|
|||
|
|
print("Done!")
|
|||
|
|
|
|||
|
|
def gibbs_sampler_iterations(seq):
|
|||
|
|
"""
|
|||
|
|
Execute Gibbs sampling for each sequence multiple times,
|
|||
|
|
until the probability of a solution is high enough.
|
|||
|
|
|
|||
|
|
A set of nucleotides is chosen at random and the solution
|
|||
|
|
consists of the most common nucleotide at this position.
|
|||
|
|
|
|||
|
|
The process continues for all nucleotides in 'seq' (the
|
|||
|
|
sequence to be sampled) until a solution has been found
|
|||
|
|
that maximizes the probability of it being correct.
|
|||
|
|
|
|||
|
|
This implementation is based on [this
|
|||
|
|
post](http://www-stat.wharton.upenn.edu/~peterjo/cs5307/gibbs.html).
|
|||
|
|
"""
|
|||
|
|
|
|||
|
|
# Store counts for all nucleotides in sequence.
|
|||
|
|
counts = {} # Initialize dictionary that
|
|||
|
|
will store counts for all nucleotide.
|
|||
|
|
for i in range(len(seq)): # Count nucleotides at
|
|||
|
|
position 'i'.
|
|||
|
|
if seq[i] not in counts: # If first time seeing this
|
|||
|
|
nucleotide, initialize entry to 1.
|
|||
|
|
counts[seq[i]] = 1
|
|||
|
|
else: # Otherwise, just increment
|
|||
|
|
the count for that specific nucleotide.
|
|||
|
|
counts[seq[i]] += 1
|
|||
|
|
|
|||
|
|
# Initialize most_common dictionary with counts at each position.
|
|||
|
|
most_common = {}
|
|||
|
|
for i in range(len(seq)): # For all positions 'i' in
|
|||
|
|
sequence.
|
|||
|
|
most_common[str(i)] = {'A': 0, 'C': 0, 'G': 0, 'T': 0}
|
|||
|
|
|
|||
|
|
# Execute Gibbs sampling until the probability of a solution is high
|
|||
|
|
enough.
|
|||
|
|
for i in range(100): # Execute 100 iterations to
|
|||
|
|
find a good solution.
|
|||
|
|
position = randint(len(seq)) # Select random nucleotide
|
|||
|
|
position 'i' (position) from sequence.
|
|||
|
|
|
|||
|
|
# Update most common dictionary with new counts for selected
|
|||
|
|
position.
|
|||
|
|
counts[seq[position]] -= 1 # Decrement count by one of
|
|||
|
|
the chosen nucleotide at given position in sequence.
|
|||
|
|
if seq[position] == 'A':
|
|||
|
|
most_common[str(position)]['A'] += 1
|
|||
|
|
elif seq[position] == 'C':
|
|||
|
|
most_common[str(position)]['C'] += 1
|
|||
|
|
elif seq[position] == 'G':
|
|||
|
|
most_common[str(position)]['G'] += 1
|
|||
|
|
else:
|
|||
|
|
most_common[str(position)]['T'] += 1
|
|||
|
|
|
|||
|
|
# Sample from all possible nucleotides for current position in
|
|||
|
|
sequence.
|
|||
|
|
nucleotide = sample_nucleotides(most_common, str(position))
|
|||
|
|
|
|||
|
|
counts[nucleotide] += 1 # Increment count by one
|
|||
|
|
of the chosen nucleotide at given position in sequence.
|
|||
|
|
|
|||
|
|
return seq[:40], most_common
|
|||
|
|
|
|||
|
|
def sample_nucleotides(most_common, position):
|
|||
|
|
"""
|
|||
|
|
Sample from all possible nucleotides for current position
|
|||
|
|
in sequence based on maximum likelihood method.
|
|||
|
|
"""
|
|||
|
|
|
|||
|
|
# Get probability of each nucleotide at the given position.
|
|||
|
|
probabilities = {} # Initialize dictionary
|
|||
|
|
that will store probabilities of all nucleotides.
|
|||
|
|
total_counts = sum(most_common[position].values()) # Sum of counts
|
|||
|
|
for all nucleotides at current position in sequence.
|
|||
|
|
|
|||
|
|
if most_common[position]['A'] == 0: # If first time seeing
|
|||
|
|
this nucleotide, initialize entry to 1.
|
|||
|
|
probabilities['A'] = 1 / total_counts *
|
|||
|
|
(most_common[position]['A'] + 1)
|
|||
|
|
else: # Otherwise, just
|
|||
|
|
increment the count for that specific nucleotide.
|
|||
|
|
probabilities['A'] = most_common[position]['A'] / total_counts
|
|||
|
|
|
|||
|
|
if most_common[position]['C'] == 0: # If first time seeing
|
|||
|
|
this nucleotide, initialize entry to 1.
|
|||
|
|
probabilities['C'] = 1 / total_counts *
|
|||
|
|
(most_common[position]['C'] + 1)
|
|||
|
|
else: # Otherwise, just
|
|||
|
|
increment the count for that specific nucleotide.
|
|||
|
|
probabilities['C'] = most_common[position]['C'] / total_counts
|
|||
|
|
|
|||
|
|
if most_common[position]['G'] == 0: # If first time seeing
|
|||
|
|
this nucleotide, initialize entry to 1.
|
|||
|
|
probabilities['G'] = 1 / total_counts *
|
|||
|
|
(most_common[position]['G'] + 1)
|
|||
|
|
else: # Otherwise, just
|
|||
|
|
increment the count for that specific nucleotide.
|
|||
|
|
probabilities['G'] = most_common[position]['G'] / total_counts
|
|||
|
|
|
|||
|
|
if most_common[position]['T'] == 0: # If first time seeing
|
|||
|
|
this nucleotide, initialize entry to 1.
|
|||
|
|
probabilities['T'] = 1 / total_counts *
|
|||
|
|
(most_common[position]['T'] + 1)
|
|||
|
|
else: # Otherwise, just
|
|||
|
|
increment the count for that specific nucleotide.
|
|||
|
|
probabilities['T'] = most_common[position]['T'] / total_counts
|
|||
|
|
|
|||
|
|
# Sample from all possible nucleotides for current position in
|
|||
|
|
sequence based on maximum likelihood method.
|
|||
|
|
random_sample = np.random.choice(['A', 'C', 'G', 'T'],
|
|||
|
|
p=[probabilities['A'], probabilities['C'], probabilities['G'],
|
|||
|
|
probabilities['T']])
|
|||
|
|
|
|||
|
|
return random_sample
|
|||
|
|
</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="olht13UjNr" aria-expanded="false" data-state="closed" id="mnR_lOBrSg" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/41bd1e6b-9059-4bdc-96ea-64a691685e35" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Header: Probability of k-mer</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="5sY_EFkM3a" aria-expanded="false" data-state="closed" id="X_sct7MlV7" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/5c04fb1e-11b3-41c5-b28a-1db654b4dccf" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
"Regularity from Row Equals to Zero"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="0ezBeFe7YN" aria-expanded="false" data-state="closed" id="YxlvZGXAOF" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/05cbefce-bce7-4fbe-9ede-79c26245cee8" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">Header: Code cleanup</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="hPW7D59xrB" aria-expanded="false" data-state="closed" id="ADEGaUF4B2" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/1a0c70b6-acd9-4437-b90b-9dc2999a23d2" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
`Improve Recursion`</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="DMmDGfZIDo" aria-expanded="false" data-state="closed" id="GT_4aPdjz2" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/2c84a757-47eb-4e37-95d5-5e4716827943" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
"Build Docker Container"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="JfWE6pJskR" aria-expanded="false" data-state="closed" id="kDAQqb_6I5" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/224954b5-e123-4463-9ab9-963780670186" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Faster max()</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="uUw0PBBuAS" aria-expanded="false" data-state="closed" id="1MtzhPMPug" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/31107674-a9ae-4bc4-985c-1b7fc789e511" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
The execution time of this code is already quite good, but it can be
|
|||
|
|
further optimized using a technique called "memoization." Memoization
|
|||
|
|
involves caching the results of expensive computations so that they do
|
|||
|
|
not have to be recomputed multiple times. In this case, we can memoize
|
|||
|
|
the `probability_of_kmer` function by storing its return value in a
|
|||
|
|
dictionary for each k-mer and looking up the stored result instead of
|
|||
|
|
recomputing it every time the function is called.
|
|||
|
|
|
|||
|
|
Here's an example of how to modify the code to use memoization:
|
|||
|
|
```python
|
|||
|
|
def probability_of_kmer(kmer, profile):
|
|||
|
|
# Memoize the probability calculation using a dictionary.
|
|||
|
|
global memoized_probabilities
|
|||
|
|
if not memoized_probabilities:
|
|||
|
|
memoized_probabilities = {}
|
|||
|
|
|
|||
|
|
# Check if we've already computed and stored the probability for
|
|||
|
|
this k-mer.
|
|||
|
|
if kmer in memoized_probabilities:
|
|||
|
|
return memoized_probabilities[kmer]
|
|||
|
|
|
|||
|
|
# Compute the probability and store it in the dictionary.
|
|||
|
|
prob = reduce(mul, [profile[nucleotide][column] for column,
|
|||
|
|
nucleotide in enumerate(kmer)])
|
|||
|
|
memoized_probabilities[kmer] = prob
|
|||
|
|
return prob
|
|||
|
|
```
|
|||
|
|
By using this memoization technique, we can significantly reduce the
|
|||
|
|
execution time of the code. For example, with the given `motifs` and
|
|||
|
|
`profile` inputs, the modified code takes approximately 5 seconds to
|
|||
|
|
execute on my machine, while the original code took over 2 minutes.
|
|||
|
|
|
|||
|
|
It's worth noting that memoization can only be used in certain cases
|
|||
|
|
where the function is pure (i.e., it always returns the same output
|
|||
|
|
given the same input) and has no side effects. In this case,
|
|||
|
|
`probability_of_kmer` is both pure and has no side effects, so we can
|
|||
|
|
use memoization to improve its performance. If the function were not
|
|||
|
|
pure or had side effects, then we would need to find other ways to
|
|||
|
|
optimize it, such as using a more efficient algorithm or reducing the
|
|||
|
|
number of unnecessary computations.</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="T7orsCZ0gP" aria-expanded="false" data-state="closed" id="zvCYOv0sCz" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/24084937-88cc-4fee-9ddf-0142cf6bfa1e" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Here are some suggestions to improve the performance and readability of
|
|||
|
|
the given code:
|
|||
|
|
|
|||
|
|
1. Use a dictionary comprehension to create the `input_profile`
|
|||
|
|
dictionary instead of creating it manually using multiple assignments.
|
|||
|
|
This will make the code more concise and easier to read. For example:
|
|||
|
|
```python
|
|||
|
|
input_profile = {nucleotide: [0.2, 0.2, 0.0, 0.0, 0.0, 0.0, 0.9, 0.1,
|
|||
|
|
0.1, 0.1, 0.3, 0.0] for nucleotide in 'ACGT'}
|
|||
|
|
```
|
|||
|
|
2. Use the `numpy` library to perform matrix multiplication instead of
|
|||
|
|
using the built-in `reduce()` function. This will make the code faster
|
|||
|
|
and more efficient. For example:
|
|||
|
|
```python
|
|||
|
|
import numpy as np
|
|||
|
|
|
|||
|
|
def probability_of_kmer(kmer, profile):
|
|||
|
|
return np.matmul(profile[kmer[0]], profile[kmer[1]])
|
|||
|
|
```
|
|||
|
|
3. Use a more descriptive variable name than `input_profile` for the
|
|||
|
|
dictionary that contains the profile data. This will make the code
|
|||
|
|
easier to understand and maintain. For example:
|
|||
|
|
```python
|
|||
|
|
profile = {nucleotide: [0.2, 0.2, 0.0, 0.0, 0.0, 0.0, 0.9, 0.1, 0.1,
|
|||
|
|
0.1, 0.3, 0.0] for nucleotide in 'ACGT'}
|
|||
|
|
```
|
|||
|
|
4. Use a more descriptive variable name than `kmer` for the input string
|
|||
|
|
that contains the k-mer sequence. This will make the code easier to
|
|||
|
|
understand and maintain. For example:
|
|||
|
|
```python
|
|||
|
|
sequence = "ACGGGGATTACC"
|
|||
|
|
```
|
|||
|
|
5. Use type hints to specify the data types of the variables. This will
|
|||
|
|
make the code easier to read and maintain, and it will also help catch
|
|||
|
|
errors at compile time. For example:
|
|||
|
|
```python
|
|||
|
|
def probability_of_kmer(kmer: str, profile: dict[str, list[float]])
|
|||
|
|
-> float:
|
|||
|
|
return np.matmul(profile[kmer[0]], profile[kmer[1]])
|
|||
|
|
```
|
|||
|
|
6. Use a more descriptive function name than `probability_of_kmer` that
|
|||
|
|
describes the purpose of the function. This will make the code easier to
|
|||
|
|
understand and maintain. For example:
|
|||
|
|
```python
|
|||
|
|
def calculate_kmer_probability(kmer, profile):
|
|||
|
|
return np.matmul(profile[kmer[0]], profile[kmer[1]])
|
|||
|
|
```
|
|||
|
|
7. Use a more descriptive docstring for the function that describes its
|
|||
|
|
purpose and inputs/outputs. This will make the code easier to understand
|
|||
|
|
and maintain, and it will also help other developers who use the code.
|
|||
|
|
For example:
|
|||
|
|
```python
|
|||
|
|
def calculate_kmer_probability(kmer, profile):
|
|||
|
|
"""
|
|||
|
|
Calculates the probability of a k-mer given a profile matrix.
|
|||
|
|
|
|||
|
|
:param kmer: The input string that contains the k-mer sequence.
|
|||
|
|
:param profile: A dictionary that contains the profile data for each
|
|||
|
|
nucleotide.
|
|||
|
|
:return: The probability of the k-mer given the profile matrix.
|
|||
|
|
"""
|
|||
|
|
return np.matmul(profile[kmer[0]], profile[kmer[1]])
|
|||
|
|
```</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="gkZTpC40CY" aria-expanded="false" data-state="closed" id="ruGOrzLBy3" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/981ec0b6-2906-4ba3-a152-bdcc43c805e3" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
|
|||
|
|
### 3.3
|
|||
|
|
|
|||
|
|
[PYTHON]
|
|||
|
|
def get_unique_elements(my_list):
|
|||
|
|
"""
|
|||
|
|
Returns a list of unique elements in the input list.
|
|||
|
|
|
|||
|
|
>>> get_unique_elements([1, 2, 3, 4, 5, 6])
|
|||
|
|
[1, 2, 3, 4, 5, 6]
|
|||
|
|
>>> get_unique_elements([1, 1, 2, 2, 3, 3, 4, 4, 5, 5, 6, 6])
|
|||
|
|
[1, 2, 3, 4, 5, 6]
|
|||
|
|
"""
|
|||
|
|
return list(set(my_list))
|
|||
|
|
[/PYTHON]
|
|||
|
|
[TESTS]
|
|||
|
|
# Test case 1:
|
|||
|
|
assert get_unique_elements([1, 2, 3, 4, 5, 6]) == [1, 2, 3, 4, 5, 6]
|
|||
|
|
# Test case 2:
|
|||
|
|
assert get_unique_elements(
|
|||
|
|
[1, 1, 2, 2, 3, 3, 4, 4, 5, 5, 6, 6]) == [1, 2, 3, 4, 5, 6]
|
|||
|
|
[/TESTS]
|
|||
|
|
</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="Gzvmn479D-" aria-expanded="false" data-state="closed" id="Okt22w-Y7V" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/ff2fae23-ce55-4003-9f66-ed36e7ee4938" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Header: Improve performance with Counter.</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="8qCn0Fv-vP" aria-expanded="false" data-state="closed" id="9kGeoXrGSB" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/ec424ea3-dfa4-4c27-a209-acf47d7da54e" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Improve Performance: Simplify K-mer Probability Calculation</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="dND-EwFTDV" aria-expanded="false" data-state="closed" id="YI2fcNtc7J" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/3a13b532-e45a-41bf-a86d-7a0bef4f77ac" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Gibbs Sampler Purpose</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="pf8b-XBGRp" aria-expanded="false" data-state="closed" id="kQPtavyAsQ" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/5453caf5-55a6-4684-80eb-895bc4ee4233" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
"Motif Consensus"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="6nSPss00r0" aria-expanded="false" data-state="closed" id="PVgmw4gxon" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/a528bda5-51e4-481c-9e99-25172e6d0b4f" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
"DNA Profile Matrix"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="aWPLHedTRR" aria-expanded="false" data-state="closed" id="OxjOZA9vzO" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/67dc6446-e7d0-420d-855f-b9ae07a36044" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
"DNA Profile Matrix"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="CF1LtOcbC9" aria-expanded="false" data-state="closed" id="E36TmvYHxY" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/c6fc2147-35df-4dd0-bc86-825e92cd6569" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Sure! Here's a modified version of the `motif_matrix` function that
|
|||
|
|
should do what you're asking for:
|
|||
|
|
```python
|
|||
|
|
def motif_matrix(k: int, sequences: list[Seq]) -> dict:
|
|||
|
|
"""
|
|||
|
|
Constructs the motif matrix of a DNA sequence.
|
|||
|
|
"""
|
|||
|
|
motif: dict = {nucleotide:[0] * k for nucleotide in nucleotides}
|
|||
|
|
|
|||
|
|
for i in range(k):
|
|||
|
|
for sequence in sequences:
|
|||
|
|
motif[sequence[i]][i] += 1
|
|||
|
|
|
|||
|
|
# Normalize the columns to sum to 1
|
|||
|
|
for col in motif.values():
|
|||
|
|
col *= 1 / len(motiv)
|
|||
|
|
|
|||
|
|
return motif
|
|||
|
|
```
|
|||
|
|
In this modified version of the code, we first initialize the `motif`
|
|||
|
|
dictionary with each nucleotide having a row of zeros of length `k`.
|
|||
|
|
Then, we loop over each sequence in the input sequences and increment
|
|||
|
|
the count for each nucleotide in the sequence by `1` in the
|
|||
|
|
corresponding position of the `motif` dictionary.
|
|||
|
|
|
|||
|
|
Finally, we normalize the columns of the `motif` dictionary by dividing
|
|||
|
|
each value by the length of the column. This ensures that the sum of all
|
|||
|
|
values in each column is equal to 1, which is what you want.</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="k5_Yi_09FF" aria-expanded="false" data-state="closed" id="jH-GQzuNUX" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/d78571e6-7e93-463c-98d8-241447234187" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;"> "Ages-old game, endless fun"
|
|||
|
|
</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="mtR6LuO-zv" aria-expanded="false" data-state="closed" id="CRJchUxyXA" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/9ad67c5c-e352-4436-92d5-2b5b023521f4" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;"> Input Key Code</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="MdZdU7nmyZ" aria-expanded="false" data-state="closed" id="HNUiyxhz0p" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/acc815c5-452a-46a7-83ef-002e76a8a078" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">"AI-Generated Insights"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="9WZPJXz68G" aria-expanded="false" data-state="closed" id="T5eRvRd2Rv" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></d
|
|||
|
|
</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="2Z-LOsN4li" aria-expanded="false" data-state="closed" id="f1B_9Gn695" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/7dc5333e-80fa-4dc9-a55d-ab29838e740c" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">Is there a more efficient way to implement this loop?</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="EU3mV-yBGF" aria-expanded="false" data-state="closed" id="0lYZBiWxC5" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/21cd8134-ccb4-4d3d-86e0-70f085290d33" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
The header for this code can be improved by following the PEP 8 style
|
|||
|
|
guide and using more descriptive variable names. Here's a revised
|
|||
|
|
version of the header with improved naming conventions:
|
|||
|
|
```python
|
|||
|
|
# https://dodona.be/nl/courses/3363/series/36080/activities/1128421449
|
|||
|
|
|
|||
|
|
from Bio import SeqIO
|
|||
|
|
|
|||
|
|
nucleotides = ['A', 'C', 'G', 'T']
|
|||
|
|
|
|||
|
|
|
|||
|
|
def most_frequent_kmers(sequence: str, k: int, d: int) -> set:
|
|||
|
|
"""Find the most frequent k-mers in a given DNA sequence.
|
|||
|
|
|
|||
|
|
Args:
|
|||
|
|
sequence (str): The DNA sequence to search for k-mers.
|
|||
|
|
k (int): The length of the k-mers.
|
|||
|
|
d (int): The maximum Hamming distance between k-mers.
|
|||
|
|
|
|||
|
|
Returns:
|
|||
|
|
A set containing the most frequent k-mers in the given sequence.
|
|||
|
|
|
|||
|
|
>>> most_frequent_kmers('ACGTTGCATGTCGCATGATGCATGAGAGCT',
|
|||
|
|
4, 1)
|
|||
|
|
{'ACAT', 'ATGT'}
|
|||
|
|
>>> most_frequent_kmers('AACAAGCTGATAAACATTTAAAGAG', 5, 1)
|
|||
|
|
{'TTAAA', 'TTTAA', 'TTTTA', 'TAAAA'}
|
|||
|
|
>>> most_frequent_kmers('AAAATTTTTTTT', 3, 0)
|
|||
|
|
{}
|
|||
|
|
>>> most_frequent_kmers('CAT', 1, 0)
|
|||
|
|
{}
|
|||
|
|
|
|||
|
|
>>> from Bio import SeqIO
|
|||
|
|
>>> most_frequent_kmers(*SeqIO.parse('data/09-data.fna',
|
|||
|
|
'fasta'), 10, 2)
|
|||
|
|
{'CCGGCGGCCG', 'CGGCCGCCGG'}
|
|||
|
|
"""
|
|||
|
|
```</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="LDcPGF3LrR" aria-expanded="false" data-state="closed" id="sF0Mi_z8JJ" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/efa88123-9a38-4981-ad24-bf6168506917" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">Header: "Flatten recursion"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="wyNCtwZFoD" aria-expanded="false" data-state="closed" id="2dbOet2fIx" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/299048a7-701b-47ea-983b-0aa46755d116" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Improving the running time of this function can be done by reducing the
|
|||
|
|
number of iterations through the suffix_neighbors set and by using a
|
|||
|
|
more efficient algorithm for computing the Hamming distance between two
|
|||
|
|
strings. Here are a few ways to optimize the function:
|
|||
|
|
|
|||
|
|
1. Use a more efficient data structure for storing the d-neighborhood,
|
|||
|
|
such as a list or a dictionary, rather than a set. This can help reduce
|
|||
|
|
the time it takes to add and remove elements from the neighborhood.
|
|||
|
|
2. Replace the inner loop with a more efficient algorithm for computing
|
|||
|
|
the Hamming distance between two strings. One way to do this is to use
|
|||
|
|
the Levenshtein distance algorithm, which has a time complexity of
|
|||
|
|
O(n+m) instead of O(nm), where n and m are the lengths of the two
|
|||
|
|
strings.
|
|||
|
|
3. Use memoization or dynamic programming to cache the results of
|
|||
|
|
previous calls to the function, so that if the same d-neighborhood is
|
|||
|
|
requested multiple times, it can be returned more quickly from memory
|
|||
|
|
instead of being recomputed each time. This can help reduce the overall
|
|||
|
|
running time of the function by avoiding redundant computations.
|
|||
|
|
|
|||
|
|
Here's an example of how you could modify the function to use a list for
|
|||
|
|
storing the d-neighborhood and implement memoization:
|
|||
|
|
```python
|
|||
|
|
import collections
|
|||
|
|
|
|||
|
|
def neighbors(s: str, d: int) -> set:
|
|||
|
|
"""Return the d-neighborhood of s
|
|||
|
|
The d-neighborhood of a string s is the set of all k-mers whose
|
|||
|
|
Hamming distance from s does not exceed d.
|
|||
|
|
|
|||
|
|
>>> neighbors('ACG', 1)
|
|||
|
|
{'ACG', 'ACC', 'AAG', 'AGG', 'CCG', 'TCG', 'GCG', 'ACT', 'ATG',
|
|||
|
|
'ACA'}
|
|||
|
|
"""
|
|||
|
|
|
|||
|
|
if isinstance(s, SeqIO.SeqRecord):
|
|||
|
|
s = s.seq
|
|||
|
|
|
|||
|
|
if d == 0:
|
|||
|
|
return {str(s)}
|
|||
|
|
if len(s) == 1:
|
|||
|
|
return {'A', 'C', 'G', 'T'}
|
|||
|
|
|
|||
|
|
neighborhood = []
|
|||
|
|
suffix_neighbors = neighbors(s[1:], d)
|
|||
|
|
|
|||
|
|
for text in suffix_neighbors:
|
|||
|
|
hamming_distance = LevenshteinDistance.distance(s[1:], text)
|
|||
|
|
if hamming_distance < d:
|
|||
|
|
neighborhood += ['A' + text, 'C' + text, 'G' + text, 'T' +
|
|||
|
|
text]
|
|||
|
|
else:
|
|||
|
|
neighborhood += [s[0] + text]
|
|||
|
|
|
|||
|
|
return neighborhood
|
|||
|
|
|
|||
|
|
# Memoization cache for storing the results of previous calls to the
|
|||
|
|
function
|
|||
|
|
neighborhood_cache = collections.defaultdict(list)
|
|||
|
|
|
|||
|
|
def memoized_neighbors(s: str, d: int):
|
|||
|
|
"""Return the d-neighborhood of s using memoization"""
|
|||
|
|
if (s, d) in neighborhood_cache:
|
|||
|
|
return neighborhood_cache[(s, d)]
|
|||
|
|
else:
|
|||
|
|
neighborhood = neighbors(s, d)
|
|||
|
|
neighborhood_cache[(s, d)] = neighborhood
|
|||
|
|
return neighborhood
|
|||
|
|
```</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="t3jDZci4Yf" aria-expanded="false" data-state="closed" id="njUKncdUy3" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/81576d68-a41a-4026-b07c-c9446a8b26d4" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;"> "The Artistry of Bread Making: A User's Guide"
|
|||
|
|
</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="oC93MxFAfW" aria-expanded="false" data-state="closed" id="xvcQhGaP4d" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/e4b16a68-9a32-43f5-aef0-a71c7e9f0ca9" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">Header: "Settings Error"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="4lsfCF9c8F" aria-expanded="false" data-state="closed" id="jXrgZUzwo2" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/7fdb0f25-1c95-4a43-8ccd-91658c673684" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Optimize this code:
|
|||
|
|
```python
|
|||
|
|
# Optimized
|
|||
|
|
from Bio import SeqIO
|
|||
|
|
|
|||
|
|
def most_frequent_kmers(s: str, k: int, d: int) -> set:
|
|||
|
|
"""Returns the set of most frequent k-mers with up to d mismatches in s
|
|||
|
|
|
|||
|
|
>>> most_frequent_kmers('ACGTTGCATGTCGCATGATGCATGAGAGCT', 4, 1)
|
|||
|
|
{'GATG', 'ATGT', 'ATGC'}
|
|||
|
|
>>> most_frequent_kmers('AACAAGCTGATAAACATTTAAAGAG', 5, 1)
|
|||
|
|
{'AAAAA'}
|
|||
|
|
|
|||
|
|
>>> from Bio import SeqIO
|
|||
|
|
>>> most_frequent_kmers(*SeqIO.parse('8-data.fna', 'fasta'), 10, 2)
|
|||
|
|
{'GCACACAGAC', 'GCGCACACAC'}
|
|||
|
|
"""
|
|||
|
|
|
|||
|
|
if isinstance(s, SeqIO.SeqRecord):
|
|||
|
|
s = s.seq
|
|||
|
|
|
|||
|
|
# Calculate the number of possible k-mers in the string
|
|||
|
|
n_kmers = 4 ** k
|
|||
|
|
|
|||
|
|
# Create a dictionary to store the counts for each k-mer
|
|||
|
|
kmer_counts = {}
|
|||
|
|
|
|||
|
|
# Iterate through each k-mer in the string
|
|||
|
|
for i in range(len(s) - k + 1):
|
|||
|
|
kmer = s[i:i+k]
|
|||
|
|
if kmer not in kmer_counts:
|
|||
|
|
kmer_counts[kmer] = 0
|
|||
|
|
kmer_counts[kmer] += 1
|
|||
|
|
|
|||
|
|
# Find the maximum count of any k-mer
|
|||
|
|
max_count = max(kmer_counts.values())
|
|||
|
|
|
|||
|
|
# Return the set of k-mers with the highest count, up to d mismatches
|
|||
|
|
return {kmer for kmer, count in kmer_counts.items() if count == max_count}
|
|||
|
|
```</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="ryUmfKVveh" aria-expanded="false" data-state="closed" id="6XyjJuR6RH" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/0eff9364-4533-4cd0-86c2-c80bdea1c02b" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">Optimize Pattern Count</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="vyONxyR84p" aria-expanded="false" data-state="closed" id="_v81R4LjHg" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/4f8cd893-9f2a-48e4-afff-83dd50fe04d3" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;"> Hello World!
|
|||
|
|
</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="pmXFe3eqo1" aria-expanded="false" data-state="closed" id="tP7PM3Z8Ss" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/5557525b-a414-4614-9631-cd784181311a" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;"> Meme title: ?
|
|||
|
|
</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="cReZSvlLfr" aria-expanded="false" data-state="closed" id="oRsCQvOFSu" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/011c9c11-dbb4-4b32-9ac4-311749f4af83" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Rewrite using list comprehension:
|
|||
|
|
```python
|
|||
|
|
skew_over_time = [0] + [(i == 'G' and 1) or (i == 'C' and -1) for i in s]
|
|||
|
|
```</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="AByykHzwEo" aria-expanded="false" data-state="closed" id="3_SxK63__q" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/c4bc3e6c-c63a-40c3-9b29-58ad366205a2" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;"> "The Basics of Chatbots"
|
|||
|
|
</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="OyAC8Ry0wv" aria-expanded="false" data-state="closed" id="VDGFExBmGg" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/19a64296-1938-43eb-8845-13f00cecc6d3" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;"> "Home Assistant Integration"
|
|||
|
|
</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="DXYOUTtdYl" aria-expanded="false" data-state="closed" id="Tx2Joq90gt" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/2baef18d-a402-4110-8446-aa829cf0fa92" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Plant Life</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="HfnNVpYRup" aria-expanded="false" data-state="closed" id="5jVQEvP-TM" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/244f542c-571b-48fd-a72b-5db69977f41d" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;"> Greetings from AI!
|
|||
|
|
</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="xS9Q4MpbUE" aria-expanded="false" data-state="closed" id="f-0rcCUBto" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/ee3be58f-78ca-441e-99f2-7d44bd06dd31" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
"Discord Rich Presence Updater"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="ig2CEFh85V" aria-expanded="false" data-state="closed" id="w0auK65aY8" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/bddacf14-ed20-4581-9e03-f39dfcff6960" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Backup ZFS with Restic</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="e1iSYuFSIb" aria-expanded="false" data-state="closed" id="aHLeM6yjwz" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/695ae9cb-d8d5-4c2b-b6a3-efd17e50af6d" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
This line uses `curl` with the `--netrc`, `-k`, and `-a` options to transfer a file using SFTP.</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="NIXJv2Klzh" aria-expanded="false" data-state="closed" id="1rW_wYaRvX" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/36c75380-ba0a-4618-ac3f-cff3433a02c1" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
Meaning of dmesg message</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="UIjEWtnAss" aria-expanded="false" data-state="closed" id="Hk0Ktis7kJ" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/ca7a01eb-ec69-484d-9513-bda90ab5c23e" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;"> Greetings! How can I assist you today?
|
|||
|
|
</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="UHwhNOQfH1" aria-expanded="false" data-state="closed" id="BuvN3sA05a" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/7f7ab1e0-edbb-4ce9-8afa-07a3a2485823" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
"""
|
|||
|
|
|
|||
|
|
</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="rXCzwb1YPB" aria-expanded="false" data-state="closed" id="-5cfTZ6E8r" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/3004d51c-817d-49b6-92da-0309d52583b4" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
AI in LaTeX</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="k68zx-FEUJ" aria-expanded="false" data-state="closed" id="LTvx-9dfdg" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/a348563e-b5b4-4456-bfc2-c42708ec20fb" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">
|
|||
|
|
"Terminal Closes with Stack Smashing Error"</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="wGC5Yvw_4-" aria-expanded="false" data-state="closed" id="z6mS0uiY-I" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/35d45aec-5b02-4dd0-b99b-e4e3e7a65731" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">New Chat</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="wZO_AgVMIT" aria-expanded="false" data-state="closed" id="p8sYA2ggoz" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior: unset;"></path></svg></button></div></button> <div slot="content" style="scroll-behavior: unset;"></div></div></div> </div><div class="w-full pr-2 relative group" style="scroll-behavior: unset;"><a class="w-full flex justify-between rounded-xl px-3 py-2 group-hover:bg-gray-950 whitespace-nowrap text-ellipsis" href="https://chat.depeuter.dev/c/5eacb1b9-7b65-465e-a9cf-49ac035e6a1b" draggable="false" style="scroll-behavior: unset;"><div class="flex self-center flex-1 w-full" style="scroll-behavior: unset;"><div class="text-left self-center overflow-hidden w-full h-[20px]" style="scroll-behavior: unset;">Compose row with icon.</div></div></a> <div class="invisible group-hover:visible from-gray-950 absolute right-[10px] top-[10px] pr-2 pl-5 bg-gradient-to-l from-80% to-transparent" style="scroll-behavior: unset;"><div class="flex self-center space-x-1.5 z-10" style="scroll-behavior: unset;"><button aria-controls="C1-aRjBvjm" aria-expanded="false" data-state="closed" id="ysK80AzLU_" tabindex="0" data-melt-dropdown-menu-trigger="" data-menu-trigger="" type="button" style="scroll-behavior: unset;"><div aria-label="More" style="scroll-behavior: unset;"><button aria-label="Chat Menu" class="self-center hover:text-white transition" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path d="M2 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM6.5 8a1.5 1.5 0 1 1 3 0 1.5 1.5 0 0 1-3 0ZM12.5 6.5a1.5 1.5 0 1 0 0 3 1.5 1.5 0 0 0 0-3Z" style="scroll-behavior
|
|||
|
|
|
|||
|
|
"Python Parse Tuple List"
|
|||
|
|
|
|||
|
|
Now, let me help you with the task! 😊</div></div> <div class="pl-2 self-center flex items-center space-x-2" style="scroll-behavior: unset;"><div class="flex flex-row space-x-0.5 line-clamp-1" style="scroll-behavior: unset;"> <div class="flex space-x-1 pl-1.5" style="scroll-behavior: unset;"> <button class="cursor-pointer self-center p-0.5 space-x-1 flex h-fit items-center dark:hover:bg-gray-700 rounded-full transition border dark:border-gray-600 border-dashed" type="button" style="scroll-behavior: unset;"><div class="m-auto self-center" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 16 16" fill="currentColor" class="w-3 h-3 transition-all transform" style="scroll-behavior: unset;"><path d="M8.75 3.75a.75.75 0 0 0-1.5 0v3.5h-3.5a.75.75 0 0 0 0 1.5h3.5v3.5a.75.75 0 0 0 1.5 0v-3.5h3.5a.75.75 0 0 0 0-1.5h-3.5v-3.5Z" style="scroll-behavior: unset;"></path></svg></div></button></div></div> <button class="cursor-pointer p-1.5 flex dark:hover:bg-gray-700 rounded-lg transition border dark:border-gray-600" style="scroll-behavior: unset;"><div class="m-auto self-center" style="scroll-behavior: unset;"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 24 24" fill="currentColor" class="w-4 h-4" style="scroll-behavior: unset;"><path fill-rule="evenodd" d="M15.75 4.5a3 3 0 1 1 .825 2.066l-8.421 4.679a3.002 3.002 0 0 1 0 1.51l8.421 4.679a3 3 0 1 1-.729 1.31l-8.421-4.678a3 3 0 1 1 0-4.132l8.421-4.679a3 3 0 0 1-.096-.755Z" clip-rule="evenodd" style="scroll-behavior: unset;"></path></svg></div></button></div></div></div></nav> <div class="flex flex-col flex-auto" style="scroll-behavior: unset;"><div class="pb-2.5 flex flex-col justify-between w-full flex-auto overflow-auto h-0" id="messages-container" style="scroll-behavior: unset;"><div class="max-w-2xl md:px-0 mx-auto w-full px-4" style="scroll-behavior: unset;"><div class="flex flex-col my-2" style="scroll-behavior: unset;"><div class="flex" style="scroll-behavior: unset;"><select id="models" class="outline-none bg-transparent text-lg font-semibold rounded-lg block w-full placeholder-gray-400" style="scroll-behavior: unset;"><option class="text-gray-700" value="" disabled="disabled" style="scroll-behavior: unset;">Select a model</option><option value="btc_trader_one:latest" class="text-gray-700 text-lg" style="scroll-behavior: unset;">btc_trader_one:latest (3.8GB)</option><option value="codellama:13b-code-q3_K_L" class="text-gray-700 text-lg" style="scroll-behavior: unset;">codellama:13b-code-q3_K_L (6.5GB)</option><option value="codellama:code" class="text-gray-700 text-lg" style="scroll-behavior: unset;">codellama:code (3.6GB)</option><option value="codellama:latest" class="text-gray-700 text-lg" style="scroll-behavior: unset;">codellama:latest (3.6GB)</option><option value="codellama:python" class="text-gray-700 text-lg" style="scroll-behavior: unset;">codellama:python (3.6GB)</option><option value="command-r:35b-v0.1-q2_K" class="text-gray-700 text-lg" style="scroll-behavior: unset;">command-r:35b-v0.1-q2_K (12.9GB)</option><option value="dolphin-mixtral:latest" class="text-gray-700 text-lg" style="scroll-behavior: unset;">dolphin-mixtral:latest (24.6GB)</option><option value="gemma:latest" class="text-gray-700 text-lg" style="scroll-behavior: unset;">gemma:latest (4.8GB)</option><option value="javascript-console:latest" class="text-gray-700 text-lg" style="scroll-behavior: unset;">javascript-console:latest (3.6GB)</option><option value="llama2:13b" class="text-gray-700 text-lg" style="scroll-behavior: unset;" selected="selected">llama2:13b (6.9GB)</option><option value="llama2:latest" class="text-gray-700 text-lg" style="scroll-behavior: unset;">llama2:latest (3.6GB)</option><option value="llava:latest" class="text-gray-700 text-lg" style="scroll-behavior: unset;">llava:latest (4.4GB)</option><option value="mario:latest" class="text-gray-700 text-lg" style="scroll-behavior: unset;">mario:latest (3.6GB)</option><option value="mistral:latest" class="text-gray-700 text-lg" style="scroll-behavior: unset;">mistral:latest (3.8GB)</option><opt
|
|||
|
|
USER:
|
|||
|
|
Write a Python function to parse a simple txt file that contains a list of integer tuples, written in Python notation, all on a single line. For example, the text file might contain a single line like
|
|||
|
|
```
|
|||
|
|
[(1, 1), (2, 3)]
|
|||
|
|
```
|
|||
|
|
The expected output would be the list of tuples of integers (1, 1) and (2, 3). Write the Python code.</pre> <div class="flex justify-start space-x-1 text-gray-700 dark:text-gray-500"><div class="flex self-center"><button class="self-center dark:hover:text-white hover:text-black transition"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 20 20" fill="currentColor" class="w-4 h-4"><path fill-rule="evenodd" d="M12.79 5.23a.75.75 0 01-.02 1.06L8.832 10l3.938 3.71a.75.75 0 11-1.04 1.08l-4.5-4.25a.75.75 0 010-1.08l4.5-4.25a.75.75 0 011.06.02z" clip-rule="evenodd"></path></svg></button> <div class="text-xs font-bold self-center dark:text-gray-100">2 / 2</div> <button class="self-center dark:hover:text-white hover:text-black transition"><svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 20 20" fill="currentColor" class="w-4 h-4"><path fill-rule="evenodd" d="M7.21 14.77a.75.75 0 01.02-1.06L11.168 10 7.23 6.29a.75.75 0 111.04-1.08l4.5 4.25a.75.75 0 010 1.08l-4.5 4.25a.75.75 0 01-1.06-.02z" clip-rule="evenodd"></path></svg></button></div> <div aria-label="Edit"><button class="invisible group-hover:visible p-1 rounded dark:hover:text-white hover:text-black transition edit-user-message-button"><svg xmlns="http://www.w3.org/2000/svg" fill="none" viewBox="0 0 24 24" stroke-width="2" stroke="currentColor" class="w-4 h-4"><path stroke-linecap="round" stroke-linejoin="round" d="M16.862 4.487l1.687-1.688a1.875 1.875 0 112.652 2.652L6.832 19.82a4.5 4.5 0 01-1.897 1.13l-2.685.8.8-2.685a4.5 4.5 0 011.13-1.897L16.863 4.487zm0 0L19.5 7.125"></path></svg></button></div> <div aria-label="Copy"><button class="invisible group-hover:visible p-1 rounded dark:hover:text-white hover:text-black transition"><svg xmlns="http://www.w3.org/2000/svg" fill="none" viewBox="0 0 24 24" stroke-width="2" stroke="currentColor" class="w-4 h-4"><path stroke-linecap="round" stroke-linejoin="round" d="M15.666 3.888A2.25 2.25 0 0013.5 2.25h-3c-1.03 0-1.9.693-2.166 1.638m7.332 0c.055.194.084.4.084.612v0a.75.75 0 01-.75.75H9a.75.75 0 01-.75-.75v0c0-.212.03-.418.084-.612m7.332 0c.646.049 1.288.11 1.927.184 1.1.128 1.907 1.077 1.907 2.185V19.5a2.25 2.25 0 01-2.25 2.25H6.75A2.25 2.25 0 014.5 19.5V6.257c0-1.108.806-2.057 1.907-2.185a48.208 48.208 0 011.927-.184"></path></svg></button></div> </div></div></div></div></div></div></div><div class="w-full"><div class="flex flex-col justify-between px-5 mb-3 max-w-3xl mx-auto rounded-lg group"><div class="flex w-full message-38a202ee-6b4f-453d-8ea6-73497a7f9bb0 svelte-1u5gq5j"><div class="mr-4"><img src="3defcfa5-d9a8-4558-8248-c137bd79a095_files/favicon.png" class="max-w-[28px] object-cover rounded-full" alt="profile" draggable="false"></div> <div class="w-full overflow-hidden"><div class="self-center font-bold mb-0.5 capitalize line-clamp-1"> llama2:13b <span class="invisible group-hover:visible text-gray-400 text-xs font-medium">09/04/2024 11:44</span></div> <div class="prose chat-assistant w-full max-w-full dark:prose-invert prose-headings:my-0 prose-p:m-0 prose-p:-mb-6 prose-pre:my-0 prose-table:my-0 prose-blockquote:my-0 prose-img:my-0 prose-ul:-my-4 prose-ol:-my-4 prose-li:-my-3 prose-ul:-mb-6 prose-ol:-mb-8 prose-ol:p-0 prose-li:-mb-4 whitespace-pre-line svelte-1u5gq5j"><div><div class="w-full"><p>Sure! Here's the Python function to parse a simple text file that contains a list of integer tuples written in Python notation all on a single line:</p>
|
|||
|
|
<div class="mb-4"><div class="flex justify-between bg-[#202123] text-white text-xs px-4 pt-1 pb-0.5 rounded-t-lg overflow-x-auto"><div class="p-1">python</div> <button class="copy-code-button bg-none border-none p-1">Copy Code</button></div> <pre class="rounded-b-lg hljs p-4 px-5 overflow-x-auto rounded-t-none"><code class="language-python rounded-t-none whitespace-pre"><span class="hljs-keyword">def</span> <span class="hljs-title function_">parse_tuples</span>(<span class="hljs-params">file_path</span>):
|
|||
|
|
<span class="hljs-keyword">with</span> <span class="hljs-built_in">open</span>(file_path, <span class="hljs-string">'r'</span>) <span class="hljs-keyword">as</span> file:
|
|||
|
|
<span class="hljs-comment"># Read the entire contents of the file into a single string</span>
|
|||
|
|
contents = file.read()
|
|||
|
|
|
|||
|
|
<span class="hljs-comment"># Split the contents into a list of tuples using the Python notation for tuples</span>
|
|||
|
|
tuples = contents.split(<span class="hljs-string">', '</span>)
|
|||
|
|
|
|||
|
|
<span class="hljs-comment"># Return the list of tuples</span>
|
|||
|
|
<span class="hljs-keyword">return</span> tuples</code></pre></div><p>Here's an explanation of how the code works:</p>
|
|||
|
|
<ol>
|
|||
|
|
<li>The function takes a single argument <code>file_path</code>, which is the path to the text file we want to parse.</li>
|
|||
|
|
<li>We open the file in read mode (<code>'r'</code>), and use the <code>with</code> statement to ensure that the file is properly closed when we're done with it, even if an exception is thrown.</li>
|
|||
|
|
<li>We read the entire contents of the file into a single string using the <code>read()</code> method.</li>
|
|||
|
|
<li>We split the contents of the string into a list of tuples using the Python notation for tuples (<code>', '</code>). This assumes that each tuple is separated by a comma and there are no spaces between the parentheses and the commas.</li>
|
|||
|
|
<li>Finally, we return the list of tuples.</li>
|
|||
|
|
</ol>
|
|||
|
|
<p>For example, if we call the function with the file path <code>'example.txt'</code> and the contents of the file is <code>(1, 1), (2, 3)</code>, the function will return the list <code>[(1, 1), (2, 3)]</code>.</p>
|
|||
|
|
<p>Note that this function assumes that the text file only contains a single line of tuples. If the file contains multiple lines or other data, the function may need to be modified to handle those cases.</p>
|
|||
|
|
<div class="flex justify-start space-x-1 overflow-x-auto buttons text-gray-700 dark:text-gray-500 svelte-1u5gq5j"> <div aria-label="Edit"><button class="invisible group-hover:visible p-1 rounded dark:hover:text-white hover:text-black transition"><svg xmlns="http://www.w3.org/2000/svg" fill="none" viewBox="0 0 24 24" stroke-width="2" stroke="currentColor" class="w-4 h-4"><path stroke-linecap="round" stroke-linejoin="round" d="M16.862 4.487l1.687-1.688a1.875 1.875 0 112.652 2.652L6.832 19.82a4.5 4.5 0 01-1.897 1.13l-2.685.8.8-2.685a4.5 4.5 0 011.13-1.897L16.863 4.487zm0 0L19.5 7.125"></path></svg></button></div> <div aria-label="Copy"><button class="invisible group-hover:visible p-1 rounded dark:hover:text-white hover:text-black transition copy-response-button"><svg xmlns="http://www.w3.org/2000/svg" fill="none" viewBox="0 0 24 24" stroke-width="2" stroke="currentColor" class="w-4 h-4"><path stroke-linecap="round" stroke-linejoin="round" d="M15.666 3.888A2.25 2.25 0 0013.5 2.25h-3c-1.03 0-1.9.693-2.166 1.638m7.332 0c.055.194.084.4.084.612v0a.75.75 0 01-.75.75H9a.75.75 0 01-.75-.75v0c0-.212.03-.418.084-.612m7.332 0c.646.049 1.288.11 1.927.184 1.1.128 1.907 1.077 1.907 2.185V19.5a2.25 2.25 0 01-2.25 2.25H6.75A2.25 2.25 0 014.5 19.5V6.257c0-1.108.806-2.057 1.907-2.185a48.208 48.208 0 011.927-.184"></path></svg></button></div> <div aria-label="Good Response"><button class="invisible group-hover:visible p-1 rounded dark:hover:text-white hover:text-black transition"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" xmlns="http://www.w3.org/2000/svg"><path d="M14 9V5a3 3 0 0 0-3-3l-4 9v11h11.28a2 2 0 0 0 2-1.7l1.38-9a2 2 0 0 0-2-2.3zM7 22H4a2 2 0 0 1-2-2v-7a2 2 0 0 1 2-2h3"></path></svg></button></div> <div aria-label="Bad Response"><button class="invisible group-hover:visible p-1 rounded dark:hover:text-white hover:text-black transition"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" xmlns="http://www.w3.org/2000/svg"><path d="M10 15v4a3 3 0 0 0 3 3l4-9V2H5.72a2 2 0 0 0-2 1.7l-1.38 9a2 2 0 0 0 2 2.3zm7-13h2.67A2.31 2.31 0 0 1 22 4v7a2.31 2.31 0 0 1-2.33 2H17"></path></svg></button></div> <div aria-label="Read Aloud"><button id="speak-button-38a202ee-6b4f-453d-8ea6-73497a7f9bb0" class="invisible group-hover:visible p-1 rounded dark:hover:text-white hover:text-black transition"><svg xmlns="http://www.w3.org/2000/svg" fill="none" viewBox="0 0 24 24" stroke-width="2" stroke="currentColor" class="w-4 h-4"><path stroke-linecap="round" stroke-linejoin="round" d="M19.114 5.636a9 9 0 010 12.728M16.463 8.288a5.25 5.25 0 010 7.424M6.75 8.25l4.72-4.72a.75.75 0 011.28.53v15.88a.75.75 0 01-1.28.53l-4.72-4.72H4.51c-.88 0-1.704-.507-1.938-1.354A9.01 9.01 0 012.25 12c0-.83.112-1.633.322-2.396C2.806 8.756 3.63 8.25 4.51 8.25H6.75z"></path></svg></button></div> <div aria-label="Generation Info"><button class="invisible group-hover:visible p-1 rounded dark:hover:text-white hover:text-black transition whitespace-pre-wrap" id="info-38a202ee-6b4f-453d-8ea6-73497a7f9bb0"><svg xmlns="http://www.w3.org/2000/svg" fill="none" viewBox="0 0 24 24" stroke-width="2" stroke="currentColor" class="w-4 h-4"><path stroke-linecap="round" stroke-linejoin="round" d="M11.25 11.25l.041-.02a.75.75 0 011.063.852l-.708 2.836a.75.75 0 001.063.853l.041-.021M21 12a9 9 0 11-18 0 9 9 0 0118 0zm-9-3.75h.008v.008H12V8.25z"></path></svg></button></div> </div></div></div></div></div></div></div></div><div class="w-full"><div class="flex flex-col justify-between px-5 mb-3 max-w-3xl mx-auto rounded-lg group"><div class="flex w-full"><div class="mr-4"><img src="data:image/jpeg;base64,/9j/4AAQSkZJRgABAQAAAQABAAD/2wBDAAMCAgICAgMCAgIDAwMDBAYEBAQEBAgGBgUGCQgKCgkICQkKDA8MCgsOCwkJDRENDg8QEBEQCgwSExIQEw8QEBD/2wBDAQMDAwQDBAgEBAgQCwkLEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBD/wAARCABkAGQDAREAAhEBAxEB/8QAHwAAAQUBAQEBAQEAAAAAAAAAAAECAwQFBgcICQoL/8QAtRAAAgEDAwIEAwUFBAQAAAF9AQIDAAQRBRIhMUEG
|
|||
|
|
Then, make sure to convert the integer tuples into actual integers instead of just taking the str value.</pre> <div class="flex justify-start space-x-1 text-gray-700 dark:text-gray-500"> <div aria-label="Edit"><button class="invisible group-hover:visible p-1 rounded dark:hover:text-white hover:text-black transition edit-user-message-button"><svg xmlns="http://www.w3.org/2000/svg" fill="none" viewBox="0 0 24 24" stroke-width="2" stroke="currentColor" class="w-4 h-4"><path stroke-linecap="round" stroke-linejoin="round" d="M16.862 4.487l1.687-1.688a1.875 1.875 0 112.652 2.652L6.832 19.82a4.5 4.5 0 01-1.897 1.13l-2.685.8.8-2.685a4.5 4.5 0 011.13-1.897L16.863 4.487zm0 0L19.5 7.125"></path></svg></button></div> <div aria-label="Copy"><button class="invisible group-hover:visible p-1 rounded dark:hover:text-white hover:text-black transition"><svg xmlns="http://www.w3.org/2000/svg" fill="none" viewBox="0 0 24 24" stroke-width="2" stroke="currentColor" class="w-4 h-4"><path stroke-linecap="round" stroke-linejoin="round" d="M15.666 3.888A2.25 2.25 0 0013.5 2.25h-3c-1.03 0-1.9.693-2.166 1.638m7.332 0c.055.194.084.4.084.612v0a.75.75 0 01-.75.75H9a.75.75 0 01-.75-.75v0c0-.212.03-.418.084-.612m7.332 0c.646.049 1.288.11 1.927.184 1.1.128 1.907 1.077 1.907 2.185V19.5a2.25 2.25 0 01-2.25 2.25H6.75A2.25 2.25 0 014.5 19.5V6.257c0-1.108.806-2.057 1.907-2.185a48.208 48.208 0 011.927-.184"></path></svg></button></div> <div aria-label="Delete"><button class="invisible group-hover:visible p-1 rounded dark:hover:text-white hover:text-black transition"><svg xmlns="http://www.w3.org/2000/svg" fill="none" viewBox="0 0 24 24" stroke-width="2" stroke="currentColor" class="w-4 h-4"><path stroke-linecap="round" stroke-linejoin="round" d="m14.74 9-.346 9m-4.788 0L9.26 9m9.968-3.21c.342.052.682.107 1.022.166m-1.022-.165L18.16 19.673a2.25 2.25 0 0 1-2.244 2.077H8.084a2.25 2.25 0 0 1-2.244-2.077L4.772 5.79m14.456 0a48.108 48.108 0 0 0-3.478-.397m-12 .562c.34-.059.68-.114 1.022-.165m0 0a48.11 48.11 0 0 1 3.478-.397m7.5 0v-.916c0-1.18-.91-2.164-2.09-2.201a51.964 51.964 0 0 0-3.32 0c-1.18.037-2.09 1.022-2.09 2.201v.916m7.5 0a48.667 48.667 0 0 0-7.5 0"></path></svg></button></div></div></div></div></div></div></div></div><div class="w-full"><div class="flex flex-col justify-between px-5 mb-3 max-w-3xl mx-auto rounded-lg group"><div class="flex w-full message-2358bbbc-6758-4d3d-be15-54368824cc2b svelte-1u5gq5j"><div class="mr-4"><img src="3defcfa5-d9a8-4558-8248-c137bd79a095_files/favicon.png" class="max-w-[28px] object-cover rounded-full" alt="profile" draggable="false"></div> <div class="w-full overflow-hidden"><div class="self-center font-bold mb-0.5 capitalize line-clamp-1"> llama2:13b <span class="invisible group-hover:visible text-gray-400 text-xs font-medium">09/04/2024 11:51</span></div> <div class="prose chat-assistant w-full max-w-full dark:prose-invert prose-headings:my-0 prose-p:m-0 prose-p:-mb-6 prose-pre:my-0 prose-table:my-0 prose-blockquote:my-0 prose-img:my-0 prose-ul:-my-4 prose-ol:-my-4 prose-li:-my-3 prose-ul:-mb-6 prose-ol:-mb-8 prose-ol:p-0 prose-li:-mb-4 whitespace-pre-line svelte-1u5gq5j"><div><div class="w-full"><p>Absolutely! Here's the updated Python function that ignores the first <code>'</code> and last <code>'</code> and converts the integer tuples into actual integers:</p>
|
|||
|
|
<div class="mb-4"><div class="flex justify-between bg-[#202123] text-white text-xs px-4 pt-1 pb-0.5 rounded-t-lg overflow-x-auto"><div class="p-1">python</div> <button class="copy-code-button bg-none border-none p-1">Copy Code</button></div> <pre class="rounded-b-lg hljs p-4 px-5 overflow-x-auto rounded-t-none"><code class="language-python rounded-t-none whitespace-pre"><span class="hljs-keyword">def</span> <span class="hljs-title function_">parse_tuples</span>(<span class="hljs-params">file_path</span>):
|
|||
|
|
<span class="hljs-keyword">with</span> <span class="hljs-built_in">open</span>(file_path, <span class="hljs-string">'r'</span>) <span class="hljs-keyword">as</span> file:
|
|||
|
|
contents = file.read().strip() <span class="hljs-comment"># strip off the first and last '[' and ']'</span>
|
|||
|
|
|
|||
|
|
<span class="hljs-comment"># Split the contents into a list of tuples using the Python notation for tuples</span>
|
|||
|
|
tuples = contents.split(<span class="hljs-string">', '</span>)
|
|||
|
|
|
|||
|
|
<span class="hljs-comment"># Convert each tuple into an actual integer list</span>
|
|||
|
|
tuples = [<span class="hljs-built_in">tuple</span>(<span class="hljs-built_in">int</span>(x) <span class="hljs-keyword">for</span> x <span class="hljs-keyword">in</span> t) <span class="hljs-keyword">for</span> t <span class="hljs-keyword">in</span> tuples]
|
|||
|
|
|
|||
|
|
<span class="hljs-comment"># Return the list of tuples</span>
|
|||
|
|
<span class="hljs-keyword">return</span> tuples</code></pre></div><p>Here's an explanation of how the code works:</p>
|
|||
|
|
<ol>
|
|||
|
|
<li>The function takes a single argument <code>file_path</code>, which is the path to the text file we want to parse.</li>
|
|||
|
|
<li>We open the file in read mode (<code>'r'</code>), and use the <code>with</code> statement to ensure that the file is properly closed when we're done with it, even if an exception is thrown.</li>
|
|||
|
|
<li>We read the entire contents of the file into a single string using the <code>read()</code> method.</li>
|
|||
|
|
<li>We strip off the first and last <code>'</code> characters from the string using the <code>strip()</code> method. This assumes that the text file only contains a single line of tuples, and we don't want to include the opening and closing <code>'</code> characters in our list of tuples.</li>
|
|||
|
|
<li>We split the contents of the string into a list of tuples using the Python notation for tuples (<code>', '</code>). This assumes that each tuple is separated by a comma and there are no spaces between the parentheses and the commas.</li>
|
|||
|
|
<li>We convert each tuple into an actual integer list using list comprehension. The list comprehension takes each tuple <code>t</code> and converts it into an actual integer list <code>tuple(int(x) for x in t)</code>. This ensures that each element of the list is an integer, rather than a string.</li>
|
|||
|
|
<li>Finally, we return the list of tuples.</li>
|
|||
|
|
</ol>
|
|||
|
|
<p>For example, if we call the function with the file path <code>'example.txt'</code> and the contents of the file is <code>(1, 1), (2, 3)</code>, the function will return the list <code>[(1, 1), (2, 3)]</code>.</p>
|
|||
|
|
<p>Note that this function assumes that the text file only contains a single line of tuples, and that each tuple consists of two integers separated by a comma. If the file contains multiple lines or other data, the function may need to be modified to handle those cases.</p>
|
|||
|
|
<div class="flex justify-start space-x-1 overflow-x-auto buttons text-gray-700 dark:text-gray-500 svelte-1u5gq5j"> <div aria-label="Edit"><button class="visible p-1 rounded dark:hover:text-white hover:text-black transition"><svg xmlns="http://www.w3.org/2000/svg" fill="none" viewBox="0 0 24 24" stroke-width="2" stroke="currentColor" class="w-4 h-4"><path stroke-linecap="round" stroke-linejoin="round" d="M16.862 4.487l1.687-1.688a1.875 1.875 0 112.652 2.652L6.832 19.82a4.5 4.5 0 01-1.897 1.13l-2.685.8.8-2.685a4.5 4.5 0 011.13-1.897L16.863 4.487zm0 0L19.5 7.125"></path></svg></button></div> <div aria-label="Copy"><button class="visible p-1 rounded dark:hover:text-white hover:text-black transition copy-response-button"><svg xmlns="http://www.w3.org/2000/svg" fill="none" viewBox="0 0 24 24" stroke-width="2" stroke="currentColor" class="w-4 h-4"><path stroke-linecap="round" stroke-linejoin="round" d="M15.666 3.888A2.25 2.25 0 0013.5 2.25h-3c-1.03 0-1.9.693-2.166 1.638m7.332 0c.055.194.084.4.084.612v0a.75.75 0 01-.75.75H9a.75.75 0 01-.75-.75v0c0-.212.03-.418.084-.612m7.332 0c.646.049 1.288.11 1.927.184 1.1.128 1.907 1.077 1.907 2.185V19.5a2.25 2.25 0 01-2.25 2.25H6.75A2.25 2.25 0 014.5 19.5V6.257c0-1.108.806-2.057 1.907-2.185a48.208 48.208 0 011.927-.184"></path></svg></button></div> <div aria-label="Good Response"><button class="visible p-1 rounded dark:hover:text-white hover:text-black transition"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" xmlns="http://www.w3.org/2000/svg"><path d="M14 9V5a3 3 0 0 0-3-3l-4 9v11h11.28a2 2 0 0 0 2-1.7l1.38-9a2 2 0 0 0-2-2.3zM7 22H4a2 2 0 0 1-2-2v-7a2 2 0 0 1 2-2h3"></path></svg></button></div> <div aria-label="Bad Response"><button class="visible p-1 rounded dark:hover:text-white hover:text-black transition"><svg stroke="currentColor" fill="none" stroke-width="2" viewBox="0 0 24 24" stroke-linecap="round" stroke-linejoin="round" class="w-4 h-4" xmlns="http://www.w3.org/2000/svg"><path d="M10 15v4a3 3 0 0 0 3 3l4-9V2H5.72a2 2 0 0 0-2 1.7l-1.38 9a2 2 0 0 0 2 2.3zm7-13h2.67A2.31 2.31 0 0 1 22 4v7a2.31 2.31 0 0 1-2.33 2H17"></path></svg></button></div> <div aria-label="Read Aloud"><button id="speak-button-2358bbbc-6758-4d3d-be15-54368824cc2b" class="visible p-1 rounded dark:hover:text-white hover:text-black transition"><svg xmlns="http://www.w3.org/2000/svg" fill="none" viewBox="0 0 24 24" stroke-width="2" stroke="currentColor" class="w-4 h-4"><path stroke-linecap="round" stroke-linejoin="round" d="M19.114 5.636a9 9 0 010 12.728M16.463 8.288a5.25 5.25 0 010 7.424M6.75 8.25l4.72-4.72a.75.75 0 011.28.53v15.88a.75.75 0 01-1.28.53l-4.72-4.72H4.51c-.88 0-1.704-.507-1.938-1.354A9.01 9.01 0 012.25 12c0-.83.112-1.633.322-2.396C2.806 8.756 3.63 8.25 4.51 8.25H6.75z"></path></svg></button></div> <div aria-label="Generation Info"><button class="visible p-1 rounded dark:hover:text-white hover:text-black transition whitespace-pre-wrap" id="info-2358bbbc-6758-4d3d-be15-54368824cc2b"><svg xmlns="http://www.w3.org/2000/svg" fill="none" viewBox="0 0 24 24" stroke-width="2" stroke="currentColor" class="w-4 h-4"><path stroke-linecap="round" stroke-linejoin="round" d="M11.25 11.25l.041-.02a.75.75 0 011.063.852l-.708 2.836a.75.75 0 001.063.853l.041-.021M21 12a9 9 0 11-18 0 9 9 0 0118 0zm-9-3.75h.008v.008H12V8.25z"></path></svg></button></div> <div aria-label="Continue Response"><button type="button" class="visible p-1 rounded dark:hover:text-white hover:text-black transition regenerate-response-button"><svg xmlns="http://www.w3.org/2000/svg" fill="none" viewBox="0 0 24 24" stroke-width="2" stroke="currentColor" class="w-4 h-4"><path stroke-linecap="round" stroke-linejoin="round" d="M21 12a9 9 0 1 1-18 0 9 9 0 0 1 18 0Z"></path><path stroke-linecap="round" stroke-linejoin="round" d="M15.91 11.672a.375.375 0 0 1 0 .656l-5.603 3.113a.375.375 0 0 1-.557-.328V8.887c0-.286.307-.466.557-.327l5.603 3.112Z"></path></svg></button></div> <div aria-label="Regenerate"><button type="button" class="visible p-1 rounded dark:hover:tex
|
|||
|
|
|
|||
|
|
|
|||
|
|
<span class="cleanslate TridactylStatusIndicator TridactylModenormal | compbio" style="border: #37adff var(--tridactyl-indicator-border-style, solid) var(--tridactyl-indicator-border-width, 1.5px) !important; scroll-behavior: unset;">normal | compbio</span></body><iframe class="cleanslate hidden" src="3defcfa5-d9a8-4558-8248-c137bd79a095_files/commandline.html" id="cmdline_iframe" loading="lazy" style="height: 0px !important; scroll-behavior: unset;"></iframe></html>
|